Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
TATATATTGCCTCACTTGGTTCTTT[C/T]TCCAGATGCTAAACAAGGTGAGATA
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 607019 | ||||||||||||||||||||
Literature Links: |
MIR548C PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
MIR548C - microRNA 548c | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MIR548Z - microRNA 548z | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
RASSF3 - Ras association domain family member 3 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_178169.3 | Intron | NP_835463.1 | ||||
XM_006719345.3 | Intron | XP_006719408.1 | ||||
XM_011538195.2 | Intron | XP_011536497.1 | ||||
XM_017019182.1 | Intron | XP_016874671.1 |