Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
TGTCACTCACGTTCTTGGCCCTGAA[A/C]ACAGGTTCCTCAGAGCCCTGCAGGT
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 603189 | ||||||||||||||||||||
Literature Links: |
LOC105369332 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
LOC105369332 - uncharacterized LOC105369332 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
RNU2-2P - RNA, U2 small nuclear 2, pseudogene | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
STX5 - syntaxin 5 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
WDR74 - WD repeat domain 74 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001307977.1 | 590 | Silent Mutation | GTG,GTT | V,V 167 | NP_001294906.1 | |
NM_018093.3 | 590 | Silent Mutation | GTG,GTT | V,V 167 | NP_060563.2 | |
XM_005274055.2 | 590 | Silent Mutation | GTG,GTT | V,V 167 | XP_005274112.1 |