Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GATCGAAGTGCATTCCAATGCTAAA[C/T]AGAAGTTATGAGTGGGTTTAACAAT
Species: |
Human | |||||||||||||||||||||||
dbSNP Submissions: |
NA
|
|||||||||||||||||||||||
Phenotype: |
MIM: 604299 | |||||||||||||||||||||||
Literature Links: |
APPL1 PubMed Links | |||||||||||||||||||||||
Allele Nomenclature: |
||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR - Not Available | |||||
AMR - Not Available |
APPL1 - adaptor protein, phosphotyrosine interacting with PH domain and leucine zipper 1 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_012096.2 | 4486 | UTR 3 | NP_036228.1 | |||
XM_011533583.2 | 4486 | UTR 3 | XP_011531885.1 |
ASB14 - ankyrin repeat and SOCS box containing 14 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001142733.2 | 4486 | Intron | NP_001136205.2 | |||
NM_130387.5 | 4486 | Intron | NP_569058.1 | |||
XM_017005736.1 | 4486 | Intron | XP_016861225.1 | |||
XM_017005737.1 | 4486 | Intron | XP_016861226.1 |
LOC105377102 - uncharacterized LOC105377102 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |