Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
ACAGTTCTGCTTCCTTTCCGCAACT[A/G]TGGCATTCGAGGTCATTCGTCATAT
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 607663 MIM: 610693 MIM: 616283 | ||||||||||||||||||||
Literature Links: |
DDX25 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
DDX25 - DEAD-box helicase 25 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_013264.4 | Intron | NP_037396.3 | ||||
XM_011542790.2 | Intron | XP_011541092.1 | ||||
XM_011542791.2 | Intron | XP_011541093.1 | ||||
XM_017017626.1 | Intron | XP_016873115.1 |
HYLS1 - HYLS1, centriolar and ciliogenesis associated | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
PUS3 - pseudouridylate synthase 3 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001271985.1 | Intron | NP_001258914.1 | ||||
NM_031307.3 | Intron | NP_112597.3 | ||||
XM_005271687.3 | Intron | XP_005271744.1 | ||||
XM_005271688.3 | Intron | XP_005271745.1 |