Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
CTCACTTCATTATGCATTCTCCAAT[A/G]ATTTGCAATGGTTGTAGCATTACTG
Species: |
Human | ||||||||||||||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||||||||||||||
Phenotype: |
|||||||||||||||||||||||||||||||||
Literature Links: |
ZNF702P PubMed Links | ||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU)
|
|||
EAS - Not Available | African American - Not Available | YRI (Yoruba)
|
|||
SAS - Not Available | Chinese - Not Available | JPT (Japanese)
|
|||
AFR - Not Available | Japanese - Not Available | CHB (Han Chinese)
|
|||
EUR - Not Available | |||||
AMR - Not Available |
ZNF702P - zinc finger protein 702, pseudogene | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
ZNF816 - zinc finger protein 816 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
ZNF816-ZNF321P - ZNF816-ZNF321P readthrough | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |