Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
AGCCTTTATTATACAATGACAACCA[A/G]ACAAGTACTCCGGATATGCAGTAGA
Species: |
Human | |||||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
NA
|
|||||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 612784 MIM: 605054 MIM: 614550 | |||||||||||||||||||||||||||||||||||||||||
Literature Links: |
HYPK PubMed Links | |||||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
||||||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | ||||||
---|---|---|---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | ||||||
EAS
|
African American - Not Available | YRI (Yoruba)
|
||||||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | ||||||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | ||||||
EUR
|
||||||||
AMR
|
HYPK - huntingtin interacting protein K | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MIR1282 - microRNA 1282 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SERF2 - small EDRK-rich factor 2 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001018108.3 | 2289 | UTR 3 | NP_001018118.1 | |||
NM_001199875.1 | 2289 | UTR 3 | NP_001186804.1 | |||
NM_001199876.1 | 2289 | UTR 3 | NP_001186805.1 | |||
NM_001199877.1 | 2289 | UTR 3 | NP_001186806.1 | |||
NM_001199878.1 | 2289 | UTR 3 | NP_001186807.1 |
SERF2-C15ORF63 - SERF2-C15orf63 readthrough | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SERINC4 - serine incorporator 4 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001258031.1 | 2289 | UTR 3 | NP_001244960.1 | |||
NM_001258032.1 | 2289 | UTR 3 | NP_001244961.1 |
Set Membership: |
HapMap |