Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
TGCTTCTGTCTCGACTGCACTTTGA[G/T]AAGGTAACCAGCATTGCACTATGCT
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 615525 | ||||||||||||||||||||
Literature Links: |
COPG1 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
COPG1 - coatomer protein complex subunit gamma 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
HMCES - 5-hydroxymethylcytosine (hmC) binding, ES cell-specific | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001006109.1 | 285 | Silent Mutation | GAG,GAT | E,D 60 | NP_001006109.1 | |
NM_020187.2 | 285 | Silent Mutation | GAG,GAT | E,D 60 | NP_064572.2 | |
XM_005247636.3 | 285 | Missense Mutation | GAG,GAT | E,D 60 | XP_005247693.1 | |
XM_005247637.3 | 285 | Missense Mutation | GAG,GAT | E,D 60 | XP_005247694.1 | |
XM_017006877.1 | 285 | Missense Mutation | GAG,GAT | E,D 60 | XP_016862366.1 |
MIR6826 - microRNA 6826 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |