Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
CACACCCCGTCTTACTGTGATGAGT[C/G]GCTGTTTGGCTCCCGATCTGAAGGC
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 611665 | ||||||||||||||||||||
Literature Links: |
DDX54 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
DDX54 - DEAD-box helicase 54 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
IQCD - IQ motif containing D | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
RITA1 - RBPJ interacting and tubulin associated 1 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001286215.1 | 1002 | Missense Mutation | TCG,TGG | S,W 137 | NP_001273144.1 | |
NM_032848.2 | 1002 | Missense Mutation | TCG,TGG | S,W 113 | NP_116237.1 | |
XM_005253972.2 | 1002 | Missense Mutation | TCG,TGG | S,W 113 | XP_005254029.1 |