Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
TTACTGGCGCCTTGATCTATGCCAT[C/T]CACGCCGAGGAGATCCTGGAGAAGC
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 615038 MIM: 602335 | ||||||||||||||||||||
Literature Links: |
CCDC114 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
CCDC114 - coiled-coil domain containing 114 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
EMP3 - epithelial membrane protein 3 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001313905.1 | 545 | Silent Mutation | ATC,ATT | I,I 120 | NP_001300834.1 | |
NM_001425.2 | 545 | Silent Mutation | ATC,ATT | I,I 120 | NP_001416.1 | |
XM_011526605.2 | 545 | Silent Mutation | ATC,ATT | I,I 120 | XP_011524907.1 |
TMEM143 - transmembrane protein 143 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |