Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GGGGCACAGTCTGCAACAAAGATAG[C/G]GTGGTCAGGGGCTGCCCACAGGCCC
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
26 submissions
|
||||||||||||||||||||
Phenotype: |
MIM: 614282 MIM: 603905 MIM: 600315 | ||||||||||||||||||||
Literature Links: |
SDF4 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
SDF4 - stromal cell derived factor 4 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
TNFRSF18 - TNF receptor superfamily member 18 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
TNFRSF4 - TNF receptor superfamily member 4 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_003327.3 | Intron | NP_003318.1 | ||||
XM_011542074.2 | Intron | XP_011540376.1 | ||||
XM_011542075.2 | Intron | XP_011540377.1 | ||||
XM_011542076.2 | Intron | XP_011540378.1 | ||||
XM_011542077.2 | Intron | XP_011540379.1 | ||||
XM_017002231.1 | Intron | XP_016857720.1 | ||||
XM_017002232.1 | Intron | XP_016857721.1 |