Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
AGAGCGGGGCTGGCGGACGGTGTTT[C/G]CCTCCCGTGAGTTCTGGCACAGGTA
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 611831 MIM: 186980 | ||||||||||||||||||||
Literature Links: |
MRPL18 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
MRPL18 - mitochondrial ribosomal protein L18 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001318817.1 | 359 | Missense Mutation | CCC,GCC | P,A 73 | NP_001305746.1 | |
NM_014161.4 | 359 | Missense Mutation | CCC,GCC | P,A 73 | NP_054880.2 |
PNLDC1 - PARN like, ribonuclease domain containing 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SNORA29 - small nucleolar RNA, H/ACA box 29 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
TCP1 - t-complex 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |