Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
CAGAAGGACAAGCGCTTCTCGGGCA[C/T]CGTCAGGTTGGCACCGTTCTGATCC
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 613976 MIM: 615660 MIM: 603170 | ||||||||||||||||||||
Literature Links: |
FANCE PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
FANCE - Fanconi anemia complementation group E | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MIR7111 - microRNA 7111 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
RPL10A - ribosomal protein L10a | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_007104.4 | Intron | NP_009035.3 | ||||
XM_017010900.1 | Intron | XP_016866389.1 |
TEAD3 - TEA domain transcription factor 3 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |