Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GTGCAGGTACGAAAAGCGCGCGCGG[A/G]GATTCCAGGAGTCGTGGTGACCAGG
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 602686 MIM: 606906 MIM: 600312 MIM: 614905 | ||||||||||||||||||||
Literature Links: |
MAD1L1 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
MAD1L1 - MAD1 mitotic arrest deficient like 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MRM2 - mitochondrial rRNA methyltransferase 2 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_013393.1 | 16 | Intron | NP_037525.1 |
NUDT1 - nudix hydrolase 1 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_002452.3 | 16 | Intron | NP_002443.3 | |||
NM_198948.1 | 16 | Intron | NP_945186.1 | |||
NM_198949.1 | 16 | Intron | NP_945187.1 | |||
NM_198950.1 | 16 | UTR 5 | NP_945188.1 | |||
NM_198952.1 | 16 | UTR 5 | NP_945190.1 | |||
NM_198953.1 | 16 | Intron | NP_945191.1 | |||
NM_198954.1 | 16 | Intron | NP_945192.1 |
SNX8 - sorting nexin 8 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |