Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
TGGCCGAGAGCTCCTTAGCTTTGGC[A/G]CTTCATGGTCCCTCTGGCTTTTCCA
Species: |
Human | ||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 616813 MIM: 606965 MIM: 109280 MIM: 614792 | ||||||||||||||||||||||||||||||||||||||
Literature Links: |
AGAP3 PubMed Links | ||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS
|
African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR
|
|||||
AMR
|
AGAP3 - ArfGAP with GTPase domain, ankyrin repeat and PH domain 3 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
FASTK - Fas activated serine/threonine kinase | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001258461.1 | Intron | NP_001245390.1 | ||||
NM_006712.4 | Intron | NP_006703.1 | ||||
NM_033015.3 | Intron | NP_148936.2 | ||||
XM_005249932.1 | Intron | XP_005249989.1 | ||||
XM_005249933.3 | Intron | XP_005249990.1 | ||||
XM_011515761.2 | Intron | XP_011514063.1 | ||||
XM_011515762.2 | Intron | XP_011514064.1 | ||||
XM_011515763.1 | Intron | XP_011514065.1 | ||||
XM_017011704.1 | Intron | XP_016867193.1 | ||||
XM_017011705.1 | Intron | XP_016867194.1 | ||||
XM_017011706.1 | Intron | XP_016867195.1 |
SLC4A2 - solute carrier family 4 member 2 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
TMUB1 - transmembrane and ubiquitin like domain containing 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |