Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
TGACTCGGCACTCAGATGGAGCACC[A/G]TGCCTGGCCAGGCTGTTCTCTGACA
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 610603 | ||||||||||||||||||||
Literature Links: |
ACCSL PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
ACCSL - 1-aminocyclopropane-1-carboxylate synthase homolog (inactive) like | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001031854.2 | Intron | NP_001027025.2 | ||||
XM_017017714.1 | Intron | XP_016873203.1 | ||||
XM_017017715.1 | Intron | XP_016873204.1 |
ALKBH3 - alkB homolog 3, alpha-ketoglutaratedependent dioxygenase | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
ALKBH3-AS1 - ALKBH3 antisense RNA 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |