Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
CCAGCCCTGAAAGCATAAACCCTGA[C/G]GTACAATTCCAGAACCCCTGGGGGT
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 606912 MIM: 613472 | ||||||||||||||||||||
Literature Links: |
MIR6882 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
MIR6882 - microRNA 6882 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SCAMP2 - secretory carrier membrane protein 2 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001320778.1 | Intron | NP_001307707.1 | ||||
NM_005697.4 | Intron | NP_005688.2 | ||||
XM_017021856.1 | Intron | XP_016877345.1 |
ULK3 - unc-51 like kinase 3 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |