Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
CGACCCTGGCTCCTCTGCCTGCCCC[C/T]TCAGGTGAGCCTGCGCTAGACCCCC
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 172471 MIM: 611421 | ||||||||||||||||||||
Literature Links: |
CCDC189 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
CCDC189 - coiled-coil domain containing 189 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
PHKG2 - phosphorylase kinase catalytic subunit gamma 2 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_000294.2 | 188 | UTR 5 | NP_000285.1 | |||
NM_001172432.1 | 188 | UTR 5 | NP_001165903.1 |
SRCAP - Snf2-related CREBBP activator protein | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
TMEM265 - transmembrane protein 265 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |