Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GCGCTGCTCCCGTTCCCCCTCCCCA[G/T]AGCAAGGTAGGGGACGCGCCCTGCC
Species: |
Human | |||||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
NA
|
|||||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 610616 MIM: 600532 | |||||||||||||||||||||||||||||||||||||||||
Literature Links: |
ANKRD12 PubMed Links | |||||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
||||||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | ||||||
---|---|---|---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | ||||||
EAS
|
African American - Not Available | YRI (Yoruba)
|
||||||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | ||||||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | ||||||
EUR
|
||||||||
AMR
|
ANKRD12 - ankyrin repeat domain 12 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001083625.2 | 308 | Intron | NP_001077094.1 | |||
NM_001204056.1 | 308 | Intron | NP_001190985.1 | |||
NM_015208.4 | 308 | Intron | NP_056023.3 | |||
XM_005258092.3 | 308 | Intron | XP_005258149.1 | |||
XM_005258093.3 | 308 | UTR 5 | XP_005258150.1 | |||
XM_005258095.2 | 308 | Intron | XP_005258152.1 | |||
XM_005258096.2 | 308 | Intron | XP_005258153.1 | |||
XM_011525638.2 | 308 | Intron | XP_011523940.1 | |||
XM_011525639.2 | 308 | UTR 5 | XP_011523941.1 | |||
XM_017025661.1 | 308 | UTR 5 | XP_016881150.1 | |||
XM_017025662.1 | 308 | Intron | XP_016881151.1 | |||
XM_017025663.1 | 308 | UTR 5 | XP_016881152.1 | |||
XM_017025664.1 | 308 | UTR 5 | XP_016881153.1 | |||
XM_017025665.1 | 308 | Intron | XP_016881154.1 | |||
XM_017025666.1 | 308 | Intron | XP_016881155.1 | |||
XM_017025667.1 | 308 | Intron | XP_016881156.1 | |||
XM_017025668.1 | 308 | Intron | XP_016881157.1 | |||
XM_017025669.1 | 308 | Intron | XP_016881158.1 | |||
XM_017025670.1 | 308 | Intron | XP_016881159.1 |
NDUFV2 - NADH:ubiquinone oxidoreductase core subunit V2 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
NDUFV2-AS1 - NDUFV2 antisense RNA 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |