Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
CTTGGATGCCCTGTTGGGTATAGAT[A/G]ACCTGGAAACCATGCCAGATGACCT
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 604064 MIM: 615497 MIM: 610225 | ||||||||||||||||||||
Literature Links: |
ATF4 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
ATF4 - activating transcription factor 4 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001675.4 | 1069 | Intron | NP_001666.2 | |||
NM_182810.2 | 1069 | Intron | NP_877962.1 | |||
XM_017028807.1 | 1069 | Missense Mutation | AAC,GAC | N,D 104 | XP_016884296.1 |
MIEF1 - mitochondrial elongation factor 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
RPS19BP1 - ribosomal protein S19 binding protein 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |