Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
TGTTTCTTCTAATCTCAATGTACTA[C/G]TGAGAGTCTCCATTTTAGATAGTAA
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
1 submissions
|
||||||||||||||||||||
Phenotype: |
MIM: 610617 MIM: 611350 | ||||||||||||||||||||
Literature Links: |
DTL PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
DTL - denticleless E3 ubiquitin protein ligase homolog | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001286229.1 | Intron | NP_001273158.1 | ||||
NM_001286230.1 | Intron | NP_001273159.1 | ||||
NM_016448.3 | Intron | NP_057532.3 | ||||
XM_011509614.1 | Intron | XP_011507916.1 |
INTS7 - integrator complex subunit 7 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
RPL21P28 - ribosomal protein L21 pseudogene 28 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |