Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
TAGCTATCACCACTATGTAGTATCA[C/G]TGGTAGGATTTTGGCCCAGGTTCAT
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 616933 | ||||||||||||||||||||
Literature Links: |
FYTTD1 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
FYTTD1 - forty-two-three domain containing 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
LRCH3 - leucine rich repeats and calponin homology domain containing 3 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_032773.3 | Intron | NP_116162.1 | ||||
XM_005269362.2 | Intron | XP_005269419.1 | ||||
XM_005269363.2 | Intron | XP_005269420.1 | ||||
XM_005269365.2 | Intron | XP_005269422.1 | ||||
XM_005269367.2 | Intron | XP_005269424.1 | ||||
XM_006713791.3 | Intron | XP_006713854.1 | ||||
XM_006713792.3 | Intron | XP_006713855.1 | ||||
XM_006713793.2 | Intron | XP_006713856.1 | ||||
XM_011513242.2 | Intron | XP_011511544.1 | ||||
XM_011513243.2 | Intron | XP_011511545.1 | ||||
XM_017007350.1 | Intron | XP_016862839.1 | ||||
XM_017007351.1 | Intron | XP_016862840.1 | ||||
XM_017007352.1 | Intron | XP_016862841.1 |