Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GACACCAGGTAGGCCTTGGGGCTAC[C/G]CATGGGCAGGCGGGGTAGGGTGAGG
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 604113 MIM: 164009 | ||||||||||||||||||||
Literature Links: |
IL18BP PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
IL18BP - interleukin 18 binding protein | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001039659.1 | Intron | NP_001034748.1 | ||||
NM_001039660.1 | Intron | NP_001034749.1 | ||||
NM_001145055.1 | Intron | NP_001138527.1 | ||||
NM_001145057.1 | Intron | NP_001138529.1 | ||||
NM_005699.3 | Intron | NP_005690.2 | ||||
NM_173042.2 | Intron | NP_766630.2 | ||||
NM_173044.2 | Intron | NP_766632.2 | ||||
XM_017017059.1 | Intron | XP_016872548.1 | ||||
XM_017017060.1 | Intron | XP_016872549.1 | ||||
XM_017017061.1 | Intron | XP_016872550.1 | ||||
XM_017017062.1 | Intron | XP_016872551.1 | ||||
XM_017017063.1 | Intron | XP_016872552.1 |
NUMA1 - nuclear mitotic apparatus protein 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
RNF121 - ring finger protein 121 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |