Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
CGAGTTCTTCGCCCCCTGGTGTGGA[C/T]ACTGCAAGAGACTTGCTCCTGAGTA
Species: |
Human | ||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
15 submissions
|
||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 613039 MIM: 603957 MIM: 602741 | ||||||||||||||||||||||||||||||||||||||
Literature Links: |
CHD1L PubMed Links | ||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS
|
African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR
|
|||||
AMR
|
CHD1L - chromodomain helicase DNA binding protein 1 like | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001256336.1 | Intron | NP_001243265.1 | ||||
NM_001256337.1 | Intron | NP_001243266.1 | ||||
NM_001256338.1 | Intron | NP_001243267.1 | ||||
NM_004284.4 | Intron | NP_004275.4 | ||||
NM_024568.2 | Intron | NP_078844.2 | ||||
XM_006711639.3 | Intron | XP_006711702.1 | ||||
XM_017002858.1 | Intron | XP_016858347.1 | ||||
XM_017002859.1 | Intron | XP_016858348.1 | ||||
XM_017002860.1 | Intron | XP_016858349.1 | ||||
XM_017002861.1 | Intron | XP_016858350.1 | ||||
XM_017002862.1 | Intron | XP_016858351.1 | ||||
XM_017002863.1 | Intron | XP_016858352.1 | ||||
XM_017002864.1 | Intron | XP_016858353.1 |
FMO5 - flavin containing monooxygenase 5 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
PDIA3P1 - protein disulfide isomerase family A member 3 pseudogene 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
PRKAB2 - protein kinase AMP-activated non-catalytic subunit beta 2 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |