Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
CTGGCCGCTTTCACCACCAGGCCCT[G/T]CTCACTTATCCACCTCACTTACTGC
Species: |
Human | ||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 612490 MIM: 616757 MIM: 611594 | ||||||||||||||||||||||||||||||||||||||
Literature Links: |
C2orf68 PubMed Links | ||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS
|
African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR
|
|||||
AMR
|
C2orf68 - chromosome 2 open reading frame 68 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001013649.3 | 2000 | UTR 3 | NP_001013671.2 | |||
XM_005264305.3 | 2000 | Intron | XP_005264362.1 |
RNF181 - ring finger protein 181 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
TMEM150A - transmembrane protein 150A | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
USP39 - ubiquitin specific peptidase 39 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001256725.1 | 2000 | Intron | NP_001243654.1 | |||
NM_001256726.1 | 2000 | Intron | NP_001243655.1 | |||
NM_001256727.1 | 2000 | Intron | NP_001243656.1 | |||
NM_001256728.1 | 2000 | Intron | NP_001243657.1 | |||
NM_006590.3 | 2000 | Intron | NP_006581.2 | |||
XM_006711922.1 | 2000 | Intron | XP_006711985.1 | |||
XM_006711923.2 | 2000 | Intron | XP_006711986.1 | |||
XM_011532487.1 | 2000 | Intron | XP_011530789.1 | |||
XM_011532488.1 | 2000 | Intron | XP_011530790.1 | |||
XM_017003182.1 | 2000 | Intron | XP_016858671.1 |