Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
CCAGCTCTACCCGACATCCCCCAAT[A/G]CAGTGCAGTCAGCGGGCCACCTGCA
Species: |
Human | ||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 138200 MIM: 609172 MIM: 603780 | ||||||||||||||||||||||||||||||||||||||
Literature Links: |
GPT PubMed Links | ||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS
|
African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR
|
|||||
AMR
|
GPT - glutamic--pyruvic transaminase | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
LOC101928953 - uncharacterized LOC101928953 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
LRRC14 - leucine rich repeat containing 14 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MFSD3 - major facilitator superfamily domain containing 3 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_138431.2 | 3480 | Intron | NP_612440.1 | |||
XM_011516806.2 | 3480 | Intron | XP_011515108.1 | |||
XM_017013005.1 | 3480 | Intron | XP_016868494.1 |
PPP1R16A - protein phosphatase 1 regulatory subunit 16A | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
RECQL4 - RecQ like helicase 4 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_004260.3 | 3480 | UTR 3 | NP_004251.3 | |||
XM_011517384.2 | 3480 | UTR 3 | XP_011515686.1 | |||
XM_017013991.1 | 3480 | Missense Mutation | XP_016869480.1 | |||
XM_017013992.1 | 3480 | Missense Mutation | XP_016869481.1 | |||
XM_017013993.1 | 3480 | Missense Mutation | XP_016869482.1 | |||
XM_017013994.1 | 3480 | Missense Mutation | XP_016869483.1 | |||
XM_017013995.1 | 3480 | Missense Mutation | XP_016869484.1 | |||
XM_017013996.1 | 3480 | UTR 3 | XP_016869485.1 | |||
XM_017013997.1 | 3480 | Missense Mutation | XP_016869486.1 | |||
XM_017013998.1 | 3480 | UTR 3 | XP_016869487.1 | |||
XM_017013999.1 | 3480 | Missense Mutation | XP_016869488.1 | |||
XM_017014000.1 | 3480 | Missense Mutation | XP_016869489.1 | |||
XM_017014001.1 | 3480 | Missense Mutation | XP_016869490.1 |