Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
CCGCCCGACGCTCCTTCTCACGGCC[C/T]GGGGCCCGGCGGCTGCTCCGGGTGG
Species: |
Human | ||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
5 submissions
|
||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 615467 MIM: 601365 MIM: 605865 | ||||||||||||||||||||||||||||||||||||||
Literature Links: |
CPTP PubMed Links | ||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS
|
African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR
|
|||||
AMR
|
CPTP - ceramide-1-phosphate transfer protein | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
DVL1 - dishevelled segment polarity protein 1 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_004421.2 | 1835 | Silent Mutation | CCA,CCG | P,P 561 | NP_004412.2 | |
XM_005244731.3 | 1835 | Silent Mutation | CCA,CCG | P,P 586 | XP_005244788.1 | |
XM_005244732.3 | 1835 | UTR 3 | XP_005244789.1 | |||
XM_005244733.3 | 1835 | UTR 3 | XP_005244790.1 |
MIR6808 - microRNA 6808 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
TAS1R3 - taste 1 receptor member 3 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |