Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
TCTTTTCTTTCATCTCTTTGTCTTG[G/T]GTCTTTATTTCTACACTCTCTTGTC
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
|||||||||||||||||||||
Literature Links: |
VN1R2 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
VN1R2 - vomeronasal 1 receptor 2 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_173856.2 | 290 | Missense Mutation | GGG,GTG | G,V 69 | NP_776255.2 |
VN1R4 - vomeronasal 1 receptor 4 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
ZNF677 - zinc finger protein 677 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |