Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
AGGGTCCAGAGCAAAAACTGGCCTA[C/T]GATCTCCTTGGAACTCAAAGATGAT
Species: |
Human | |||||||||||||||||||||||
dbSNP Submissions: |
NA
|
|||||||||||||||||||||||
Phenotype: |
MIM: 612102 MIM: 608979 MIM: 611059 | |||||||||||||||||||||||
Literature Links: |
MIRLET7G PubMed Links | |||||||||||||||||||||||
Allele Nomenclature: |
||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR - Not Available | |||||
AMR - Not Available |
MIRLET7G - microRNA let-7g | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
PPM1M - protein phosphatase, Mg2+/Mn2+ dependent 1M | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
WDR82 - WD repeat domain 82 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_025222.3 | Intron | NP_079498.2 | ||||
XM_011534136.2 | Intron | XP_011532438.1 |