Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
CCACCTCACCTTGCTGCTGCACCAC[A/G]CGGTGATGCACTCCCAGCAGAACAG
Species: |
Human | ||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
10 submissions
|
||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 602859 MIM: 612836 | ||||||||||||||||||||||||||||||||||||||
Literature Links: |
PEX10 PubMed Links | ||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS
|
African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR
|
|||||
AMR
|
PEX10 - peroxisomal biogenesis factor 10 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_002617.3 | 1025 | Missense Mutation | GCG,GTG | A,V 299 | NP_002608.1 | |
NM_153818.1 | 1025 | Missense Mutation | GCG,GTG | A,V 319 | NP_722540.1 | |
XM_011541573.1 | 1025 | Missense Mutation | GCG,GTG | A,V 318 | XP_011539875.1 | |
XM_011541576.1 | 1025 | Intron | XP_011539878.1 |
PLCH2 - phospholipase C eta 2 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
RER1 - retention in endoplasmic reticulum sorting receptor 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |