Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GCAGCAATGGCAGTGACGGCGTTGG[C/G]GGCGCGGACGTGGCTTGGCGTGTGG
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
2 submissions
|
||||||||||||||||||||
Phenotype: |
MIM: 614981 | ||||||||||||||||||||
Literature Links: |
ATPIF1 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
ATPIF1 - ATPase inhibitory factor 1 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_016311.4 | 113 | Missense Mutation | GCG,GGG | A,G 7 | NP_057395.1 | |
NM_178190.2 | 113 | Missense Mutation | GCG,GGG | A,G 7 | NP_835497.1 | |
NM_178191.2 | 113 | Missense Mutation | GCG,GGG | A,G 7 | NP_835498.1 |
DNAJC8 - DnaJ heat shock protein family (Hsp40) member C8 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
LOC105376896 - uncharacterized LOC105376896 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |