Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
TACTGCTGCCCGTAGGCCCGGTTGT[A/C]GTAGCCTCGGCGCTGCCCGCCCACT
Species: |
Human | ||||||||||||||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 606158 MIM: 608941 | ||||||||||||||||||||||||||||||||
Literature Links: |
BSCL2 PubMed Links | ||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU)
|
|||
EAS - Not Available | African American - Not Available | YRI (Yoruba)
|
|||
SAS - Not Available | Chinese - Not Available | JPT (Japanese)
|
|||
AFR - Not Available | Japanese - Not Available | CHB (Han Chinese)
|
|||
EUR - Not Available | |||||
AMR - Not Available |
BSCL2 - BSCL2, seipin lipid droplet biogenesis associated | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
GNG3 - G protein subunit gamma 3 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
HNRNPUL2 - heterogeneous nuclear ribonucleoprotein U like 2 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001079559.2 | 2234 | Missense Mutation | NP_001073027.1 |
HNRNPUL2-BSCL2 - HNRNPUL2-BSCL2 readthrough (NMD candidate) | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |