Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
CAAAGTAGAACAAAGATTACGTTTT[A/G]TCACAGGGAGCAGGAGGGAATGGGA
Species: |
Human | ||||||||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 609096 MIM: 610894 | ||||||||||||||||||||||||||||||||||||||||||||
Literature Links: |
FBXO22 PubMed Links | ||||||||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | ||||||
---|---|---|---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | ||||||
EAS
|
African American - Not Available | YRI (Yoruba) - Not Available | ||||||
SAS
|
Chinese - Not Available | JPT (Japanese)
|
||||||
AFR
|
Japanese - Not Available | CHB (Han Chinese)
|
||||||
EUR
|
||||||||
AMR
|
FBXO22 - F-box protein 22 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
FBXO22-AS1 - FBXO22 antisense RNA 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
NRG4 - neuregulin 4 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_138573.3 | 5521 | Intron | NP_612640.1 | |||
XM_017021937.1 | 5521 | Intron | XP_016877426.1 | |||
XM_017021938.1 | 5521 | Intron | XP_016877427.1 | |||
XM_017021939.1 | 5521 | Intron | XP_016877428.1 | |||
XM_017021940.1 | 5521 | Intron | XP_016877429.1 | |||
XM_017021941.1 | 5521 | Intron | XP_016877430.1 | |||
XM_017021942.1 | 5521 | Intron | XP_016877431.1 | |||
XM_017021943.1 | 5521 | Intron | XP_016877432.1 | |||
XM_017021944.1 | 5521 | Intron | XP_016877433.1 | |||
XM_017021945.1 | 5521 | UTR 3 | XP_016877434.1 | |||
XM_017021946.1 | 5521 | Intron | XP_016877435.1 | |||
XM_017021947.1 | 5521 | UTR 3 | XP_016877436.1 | |||
XM_017021948.1 | 5521 | UTR 3 | XP_016877437.1 |
Set Membership: |
HapMap |