Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
TTTTACCCCCCCCAACAATCCTTTT[C/T]CTGAAATAATTCAAATTTTCTGTTT
Species: |
Human | |||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
NA
|
|||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 609916 | |||||||||||||||||||||||||||||||||||
Literature Links: |
AZI2 PubMed Links | |||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | ||||||
---|---|---|---|---|---|---|---|---|
Global
|
Caucasian
|
CEPH (CEU) - Not Available | ||||||
EAS - Not Available | African American
|
YRI (Yoruba) - Not Available | ||||||
SAS - Not Available | Japanese
|
CHB (Han Chinese) - Not Available | ||||||
AFR - Not Available | Chinese
|
JPT (Japanese) - Not Available | ||||||
EUR - Not Available | ||||||||
AMR - Not Available |
AZI2 - 5-azacytidine induced 2 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
ZCWPW2 - zinc finger CW-type and PWWP domain containing 2 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001040432.3 | Intron | NP_001035522.1 | ||||
NM_001324169.1 | Intron | NP_001311098.1 | ||||
NM_001324170.1 | Intron | NP_001311099.1 | ||||
XM_017005755.1 | Intron | XP_016861244.1 | ||||
XM_017005756.1 | Intron | XP_016861245.1 | ||||
XM_017005757.1 | Intron | XP_016861246.1 | ||||
XM_017005758.1 | Intron | XP_016861247.1 | ||||
XM_017005759.1 | Intron | XP_016861248.1 |