Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
ATTGAAACTTGGACCTGCTGGGGCT[A/G]TGGGGGATTCTGAAGGTGGCAATGC
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 601124 | ||||||||||||||||||||
Literature Links: |
LOC107986035 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
LOC107986035 - basic proline-rich protein-like | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SEMA3F - semaphorin 3F | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001318798.1 | Intron | NP_001305727.1 | ||||
NM_001318800.1 | Intron | NP_001305729.1 | ||||
NM_004186.4 | Intron | NP_004177.3 | ||||
XM_005265381.4 | Intron | XP_005265438.1 | ||||
XM_005265382.4 | Intron | XP_005265439.1 | ||||
XM_006713289.3 | Intron | XP_006713352.1 | ||||
XM_006713290.3 | Intron | XP_006713353.1 | ||||
XM_011533998.2 | Intron | XP_011532300.1 | ||||
XM_011534000.2 | Intron | XP_011532302.1 |
SEMA3F-AS1 - SEMA3F antisense RNA 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |