Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GCCCGGCTGAGGCGCCAGTACCCGG[C/T]CCGGTCCGCATTTCGCCTTCCGGCT
Species: |
Human | ||||||||||||||||||||||||||||||||
dbSNP Submissions: |
21 submissions
|
||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 185261 MIM: 601607 | ||||||||||||||||||||||||||||||||
Literature Links: |
MMP11 PubMed Links | ||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS
|
African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR - Not Available | |||||
MMP11 - matrix metallopeptidase 11 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SMARCB1 - SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily b, member 1 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001007468.2 | Intron | NP_001007469.1 | ||||
NM_001317946.1 | Intron | NP_001304875.1 | ||||
NM_003073.4 | Intron | NP_003064.2 | ||||
XM_011530345.2 | Intron | XP_011528647.1 |