Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GCCCAGGTGGCGTTCTCTTCTCAGC[A/G]GGCACAAAGGGCATCCCAGGGCAGG
Species: |
Human | ||||||||||||||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
34 submissions
|
||||||||||||||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 609613 MIM: 610817 | ||||||||||||||||||||||||||||||||||||||||||||||||||
Literature Links: |
PLEKHM2 PubMed Links | ||||||||||||||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | ||||||
---|---|---|---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU)
|
||||||
EAS
|
African American - Not Available | YRI (Yoruba)
|
||||||
SAS
|
Chinese - Not Available | JPT (Japanese)
|
||||||
AFR
|
Japanese - Not Available | CHB (Han Chinese)
|
||||||
EUR
|
||||||||
AMR
|
PLEKHM2 - pleckstrin homology and RUN domain containing M2 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_015164.2 | 384 | Intron | NP_055979.2 | |||
XM_005245790.3 | 384 | Intron | XP_005245847.1 | |||
XM_005245791.4 | 384 | Intron | XP_005245848.1 | |||
XM_017000757.1 | 384 | Intron | XP_016856246.1 | |||
XM_017000758.1 | 384 | Intron | XP_016856247.1 |
SLC25A34 - solute carrier family 25 member 34 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_207348.2 | 384 | Intron | NP_997231.1 | |||
XM_011541292.2 | 384 | UTR 5 | XP_011539594.1 | |||
XM_011541293.1 | 384 | UTR 5 | XP_011539595.1 | |||
XM_017001083.1 | 384 | UTR 5 | XP_016856572.1 |
TMEM82 - transmembrane protein 82 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
Set Membership: |
HapMap |