Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
CCATCGCAGCGCGCCGGGAGTGTGG[C/T]GTTCTGTGAAGAGTTCGGTGCTAAC
Species: |
Human | ||||||||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 611256 MIM: 603624 MIM: 605915 | ||||||||||||||||||||||||||||||||||||||||||||
Literature Links: |
NOXO1 PubMed Links | ||||||||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | ||||||
---|---|---|---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU)
|
||||||
EAS
|
African American - Not Available | YRI (Yoruba)
|
||||||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | ||||||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | ||||||
EUR
|
||||||||
AMR
|
NOXO1 - NADPH oxidase organizer 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
RNF151 - ring finger protein 151 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
RPS2 - ribosomal protein S2 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SNHG9 - small nucleolar RNA host gene 9 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SNORA10 - small nucleolar RNA, H/ACA box 10 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SNORA64 - small nucleolar RNA, H/ACA box 64 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SNORA78 - small nucleolar RNA, H/ACA box 78 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
TBL3 - transducin beta like 3 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_006453.2 | 11 | UTR 5 | NP_006444.2 |
Set Membership: |
HapMap |