Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GGCTGACAGCAAAGAGCTGCTCTCT[A/G]TGGGCCTGCTTCATCTCATCCGAGA
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 171840 | ||||||||||||||||||||
Literature Links: |
PFKP PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
PFKP - phosphofructokinase, platelet | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
PITRM1 - pitrilysin metallopeptidase 1 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001242307.1 | 2933 | Silent Mutation | NP_001229236.1 | |||
NM_001242309.1 | 2933 | Silent Mutation | NP_001229238.1 | |||
NM_014889.3 | 2933 | Silent Mutation | NP_055704.2 | |||
XM_005252345.3 | 2933 | Silent Mutation | XP_005252402.1 | |||
XM_017015470.1 | 2933 | Silent Mutation | XP_016870959.1 | |||
XM_017015471.1 | 2933 | Silent Mutation | XP_016870960.1 | |||
XM_017015472.1 | 2933 | Silent Mutation | XP_016870961.1 | |||
XM_017015473.1 | 2933 | Silent Mutation | XP_016870962.1 |
PITRM1-AS1 - PITRM1 antisense RNA 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SNORD142 - small nucleolar RNA, C/D box 142 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |