Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
AAACCCCCCATCCAGATATATTCAC[A/G]TTAACAATTCTGAGATAACTGCTGC
Species: |
Human | |||||||||||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
NA
|
|||||||||||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 601102 MIM: 102577 MIM: 180647 MIM: 611334 | |||||||||||||||||||||||||||||||||||||||||||||||
Literature Links: |
EIF4A2 PubMed Links | |||||||||||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
||||||||||||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | ||||||
---|---|---|---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU)
|
||||||
EAS
|
African American - Not Available | YRI (Yoruba) - Not Available | ||||||
SAS
|
Chinese - Not Available | JPT (Japanese)
|
||||||
AFR
|
Japanese - Not Available | CHB (Han Chinese)
|
||||||
EUR
|
||||||||
AMR
|
EIF4A2 - eukaryotic translation initiation factor 4A2 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001967.3 | 1375 | Intron | NP_001958.2 |
MIR1248 - microRNA 1248 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
RFC4 - replication factor C subunit 4 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_002916.3 | 1375 | UTR 3 | NP_002907.1 | |||
NM_181573.2 | 1375 | UTR 3 | NP_853551.1 |
SNORA4 - small nucleolar RNA, H/ACA box 4 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SNORA63 - small nucleolar RNA, H/ACA box 63 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SNORA81 - small nucleolar RNA, H/ACA box 81 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SNORD2 - small nucleolar RNA, C/D box 2 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
Set Membership: |
HapMap |