Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
TTGCACAAAAGAGAGAGAAGAAAAT[G/T]GTAAGCTTCCTGGGAGAGGAAGAGA
Species: |
Human | |||||||||||||||||||||||
dbSNP Submissions: |
NA
|
|||||||||||||||||||||||
Phenotype: |
MIM: 612385 MIM: 616715 MIM: 614586 | |||||||||||||||||||||||
Literature Links: |
MED19 PubMed Links | |||||||||||||||||||||||
Allele Nomenclature: |
||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese)
|
|||
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR - Not Available | |||||
AMR - Not Available |
MED19 - mediator complex subunit 19 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001317078.1 | 1550 | UTR 3 | NP_001304007.1 | |||
NM_153450.2 | 1550 | UTR 3 | NP_703151.2 |
TMX2 - thioredoxin related transmembrane protein 2 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
TMX2-CTNND1 - TMX2-CTNND1 readthrough (NMD candidate) | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
ZDHHC5 - zinc finger DHHC-type containing 5 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |