Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
TTAAATCATAAATGTACAACAGCTT[C/T]TTAACTCTACACACGCACTTAAATT
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 604477 MIM: 600124 MIM: 604135 | ||||||||||||||||||||
Literature Links: |
CBX3 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
CBX3 - chromobox 3 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
HNRNPA2B1 - heterogeneous nuclear ribonucleoprotein A2/B1 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_002137.3 | 1749 | UTR 3 | NP_002128.1 | |||
NM_031243.2 | 1749 | UTR 3 | NP_112533.1 | |||
XM_005249729.1 | 1749 | Intron | XP_005249786.1 | |||
XM_017012109.1 | 1749 | Intron | XP_016867598.1 | |||
XM_017012110.1 | 1749 | Intron | XP_016867599.1 |
NFE2L3 - nuclear factor, erythroid 2 like 3 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |