Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
TGGCTGGTCCCTGTGATGTGGCATT[C/G]ATAGCACCCAATGTACAAATTTCCC
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 602836 MIM: 616484 | ||||||||||||||||||||
Literature Links: |
EMC6 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
EMC6 - ER membrane protein complex subunit 6 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
P2RX5 - purinergic receptor P2X 5 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001204519.1 | 1715 | UTR 3 | NP_001191448.1 | |||
NM_001204520.1 | 1715 | UTR 3 | NP_001191449.1 | |||
NM_002561.3 | 1715 | UTR 3 | NP_002552.2 | |||
NM_175080.2 | 1715 | UTR 3 | NP_778255.1 |
P2RX5-TAX1BP3 - P2RX5-TAX1BP3 readthrough (NMD candidate) | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
TAX1BP3 - Tax1 binding protein 3 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |