Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
CAACCTTGAACATGTTACTTTTTAT[A/G]TTAATGAAACTCAGTTTTCTAGTCC
Species: |
Human | ||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
10 submissions
|
||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 608398 | ||||||||||||||||||||||||||||||||||||||
Literature Links: |
CSMD2 PubMed Links | ||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS
|
African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR
|
|||||
AMR
|
CSMD2 - CUB and Sushi multiple domains 2 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001281956.1 | 660 | Intron | NP_001268885.1 | |||
NM_052896.4 | 660 | Intron | NP_443128.2 | |||
XM_017000185.1 | 660 | Intron | XP_016855674.1 | |||
XM_017000186.1 | 660 | Intron | XP_016855675.1 | |||
XM_017000187.1 | 660 | Intron | XP_016855676.1 | |||
XM_017000188.1 | 660 | Intron | XP_016855677.1 | |||
XM_017000189.1 | 660 | Intron | XP_016855678.1 | |||
XM_017000190.1 | 660 | Intron | XP_016855679.1 | |||
XM_017000191.1 | 660 | Intron | XP_016855680.1 | |||
XM_017000192.1 | 660 | Intron | XP_016855681.1 | |||
XM_017000193.1 | 660 | Intron | XP_016855682.1 | |||
XM_017000194.1 | 660 | Intron | XP_016855683.1 |
CSMD2-AS1 - CSMD2 antisense RNA 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
HMGB4 - high mobility group box 4 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_145205.5 | 660 | UTR 5 | NP_660206.2 |