Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
ACTGGGGAGACCACCCAGGTACAGG[A/G]CGGAAGCCACCTGCCACAAGTCGCC
Species: |
Human | ||||||||||||||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 608235 | ||||||||||||||||||||||||||||||||
Literature Links: |
C7orf43 PubMed Links | ||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU)
|
|||
EAS - Not Available | African American - Not Available | YRI (Yoruba)
|
|||
SAS - Not Available | Chinese - Not Available | JPT (Japanese)
|
|||
AFR - Not Available | Japanese - Not Available | CHB (Han Chinese)
|
|||
EUR - Not Available | |||||
AMR - Not Available |
C7orf43 - chromosome 7 open reading frame 43 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001303470.1 | Intron | NP_001290399.1 | ||||
NM_018275.4 | Intron | NP_060745.3 |
GAL3ST4 - galactose-3-O-sulfotransferase 4 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
LAMTOR4 - late endosomal/lysosomal adaptor, MAPK and MTOR activator 4 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MIR4658 - microRNA 4658 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |