Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
TGAAGATCTTTTCTGGTAAGACTAC[A/G]TAGTCTACTACAGGGGAAGAACTTA
Species: |
Mouse |
dbSNP Submissions: |
NA
|
Phenotype: |
|
Literature Links: |
1700001P01Rik PubMed Links |
1700001P01Rik - RIKEN cDNA 1700001P01 gene | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
Rpl23 - ribosomal protein L23 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_022891.3 | Intron | NP_075029.1 |
Snora21 - small nucleolar RNA, H/ACA box 21 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |