Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
AACCTTTATAAATGTGAGTAGAGAG[C/G]TCTTCTTCATAGATAGATCTTAGCC
Species: |
Mouse |
dbSNP Submissions: |
NA
|
Phenotype: |
|
Literature Links: |
1700087M22Rik PubMed Links |
1700087M22Rik - RIKEN cDNA 1700087M22 gene | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
Sfmbt1 - Scm-like with four mbt domains 1 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001166531.1 | Intron | NP_001160003.1 | ||||
NM_001166532.1 | Intron | NP_001160004.1 | ||||
NM_019460.2 | Intron | NP_062333.1 |