Hamburger Menu Button
Thermo Fisher Scientific Logo
Sign in
Don't have an account ? Create Account
  • Products
    • Antibodies
    • Cell Culture and Transfection
    • Chemicals
    • Chromatography
    • Electron Microscopes
    • Lab Plasticware and Supplies
    • Lab Centrifuges
    • Lab Solutions
    • Mass Spectrometers
    • Next Generation Sequencers
    • See all product categories
  • Applications
    • Brands
    • Industrial and Applied Sciences
    • Food and Beverage
    • Forensics
    • Lab Solutions
    • Life Sciences
    • Pharma and Biopharma
    • Biotechnology
    • Clinical and Diagnostics
    • Digital Solutions
    • See all applications
  • Services
    • Lab Instrument and Equipment Services
    • Custom Services
    • Training Services
    • Financial and Leasing Services
    • Enterprise Level Lab Informatics
    • Partnering and Licensing Services
    • 360° CDMO and CRO Solutions
    • CDMO Services
    • CRO Services
    • Cell Biology Services
    • Food Safety Inspection Services
    • See all services
  • Help and Support
    • Contact Us
    • Product Documentation
    • Knowledge Base and Product FAQs
    • Learning Centers
    • Supply Center
    • eProcurement Solutions
    • Lab Instrument and Equipment Support
    • See all help and support topics
  • Popular
    • TaqMan Real-Time PCR Assays
      TaqMan Real-Time PCR Assays
    • Antibodies
      Antibodies
    • Oligos, Primers & Probes
      Oligos, Primers & Probes
    • GeneArt Gene Synthesis
      GeneArt Gene Synthesis
    • Cell Culture Plastics
      Cell Culture Plastics
  • Who We Serve
    • Biotech
    • Biopharma
    • CDMO
    • Lab Diagnostics
    • Industrial and Applied Sciences
  • Special Offers
  • Contact Us
  • Quick Order
  • Order Status and Tracking
  • Documents and Certificates
Thermo Fisher Scientific Logo

Search

Search All
Search button
          • Order Status
          • Quick Order
          • Sign in
            Sign in
            Don't have an account ? Create Account
            • Account
            • Check Order Status
            • Custom Products & Projects
            • Instrument Management
          This product has been added to your favorites list. Go to My Favorites

          System Message

          OKCancel
          LOADING ...
          • Home
          • › Search Tool
          • › Search Results
          • › PM19945
          Assay Name: mmu-miR-669d-2-3p
          miRBase Accession Number: MI0014051
          miRBase Version: v22.1
          Chromosome Location: Chr.2: 10471644 - 10471729 [+] on Build GRCm38
          Mature miRNA Sequence: AUAUACAUACACACCCAUAUAC
          Species: Mouse
          Product Type: Ambion® Pre-miR™ miRNA Precursor
          Assay ID PM19945
          Size
          Availability Made To Order
          Catalog # AM17100
          Price
          Your Price
          Online offer:
          Check your price ›
          • Genomic Map
          • Assay Details
          • More Information

          Genomic Map

          LOADING...
          ×
          Back To Top

          Assay Details

          Gene Family ID:

          MIPF0000316, mir-467

          Mature miRNA Sequence:

          AUAUACAUACACACCCAUAUAC

          miRBase Details:



          Species miRBase ID miRBase Accession Number
          Mouse mmu-miR-669d-2-3p MIMAT0014884

          Stem-loop Details



          Mouse

          Stem-loop ID mmu-mir-669d-2
          Stem-loop Accession # MI0014051
          Stem-loop Sequence
          GUGCAUGUGUGUAUACUUGUGUGUGCAUGUAUAUGUGUCUAUAUGAAUAUACAUAUACAUACACACCCAUAUACACACGCAUGCAC
          Chromosome Location Chr. 2 - 10471644 - 10471729 [+] on Build GRCm38
          Mature MicroRNA miRBase Accession #: MIMAT0014884
          miRBase ID: mmu-miR-669d-2-3p
          Mature miRNA Sequence: AUAUACAUACACACCCAUAUAC
          Chromosome Location: Chr. 2 - 10471644 - 10471729 [+] on Build GRCm38


          Back To Top

          More Information




          Related Products

          TaqMan™ Pri-miRNA Assay : Mm04229108_pri
          Ambion® Anti-miR™ miRNA Inhibitor : AM19945
          TaqMan™ MicroRNA Assay : 463920_mat
          mirVana® miRNA inhibitor : MH19945
          mirVana® miRNA mimic : MC19945


          miRBase Alias:

          Mouse: mmu-miR-669d-2* (v17)

          Back To Top

          Related Products

          Ordering Plus Icon Minus Icon
          • Quick Order
          • eProcurement
          • Supply Center
          • Order Status
          • Chemicals
          • India Mobile App
          • Government eMarketplace
          Support Plus Icon Minus Icon
          • Order Support
          • Training
          • Contact Us
          • Report a Site Issue
          • Instrument Management
          Resources Plus Icon Minus Icon
          • Product Selection Guides
          • Mobile & Desktop Apps
          • Webinars
          • Blog 
          • Social Media
          • New Products
          • Promotions
          • Shared Lists
          About Thermo Fisher Plus Icon Minus Icon
          • About Us About Us
          • Careers Careers
          • Investors Investors
          • News News
          • Social Responsibility Social Responsibility
          • Trademarks
          • Policies and Notices
          Our Portfolio Plus Icon Minus Icon
          • Thermo Scientific
          • Applied Biosystems
          • Invitrogen
          • Gibco
          • Ion Torrent
          • Fisher Scientific
          • Patheon
          • PPD
          • Terms & Conditions
          • Privacy Policy
          • Price & Freight Policy
          © 2006-2026 Thermo Fisher Scientific Inc. All rights reserved. All trademarks are the property of Thermo Fisher Scientific and its subsidiaries unless otherwise specified.
          India flag icon
          India

          Your items have has been added!


          Host server : magellan-search-green-b49b87d85-pgj68:80/100.66.79.163:80.
          git-commit: 5b8c860b7cdb41e9cfe07630520f6b51e109d38e
          git-url: https://github.com/thermofisher/magellan-search
          git-branch: release/2.47.0-Offline