Shop All DNA⁄RNA Polymerases

SP6 RNA Polymerase (20 U/µL) (Thermo Scientific™)

Thermo Scientific Bacteriophage SP6 RNA polymerase is a DNA-dependent RNA polymerase with strict specificity for its respective double-stranded promoters. It catalyzes the 5'→3' synthesis of RNA on either single-stranded DNA or double-stranded DNA downstream from its promoter and incorporates modified nucleotides.

Highlights

Incorporates modified nucleotides (e.g., aminoallyl-, biotin-, fluorescein-, digoxigenin-labeled nucleotides)

Applications

• Synthesis of unlabeled and labeled RNA that can be used:
• For hybridization, in vitro RNA translation
• As aRNA, siRNA, substrate in RNase protection assays, template for genomic DNA sequencing
• In studies of RNA secondary structure and RNA-protein interactions, RNA splicing

Consensus promoter sequence:
SP6: ATTTAGGTGACACTATAGAAGNG

DNA Polymerase I (10 U/µL) (Thermo Scientific™)

Thermo Scientific DNA Polymerase I, a template-dependent DNA polymerase, catalyzes 5'→3' synthesis of DNA. The enzyme also exhibits 3'→5' exonuclease (proofreading) activity, 5'→3' exonuclease activity, and ribonuclease H activity.

Highlights

• Incorporates modified nucleotides (e.g. biotin-, digoxigenin-, aminoallyl-, fluorescently-labeled nucleotides)
• Active in multiple buffers, including restriction enzyme, PCR, and RT buffers

Applications

• DNA labeling by nick-translation in conjunction with DNase
• Second-strand synthesis of cDNA in conjunction with RNase H

SP6 RNA Polymerase, HC (≥100 U/µL) (Thermo Scientific™)

Thermo Scientific Bacteriophage SP6 RNA polymerase is a DNA-dependent RNA polymerase with strict specificity for its respective double-stranded promoters. It catalyzes the 5'→3' synthesis of RNA on either single-stranded DNA or double-stranded DNA downstream from its promoter and incorporates modified nucleotides.

Highlights

Incorporates modified nucleotides (e.g., aminoallyl-, biotin-, fluorescein-, digoxigenin-labeled nucleotides)

Applications

• Synthesis of unlabeled and labeled RNA that can be used:
• For hybridization, in vitro RNA translation
• As aRNA, siRNA, substrate in RNase protection assays, template for genomic DNA sequencing
• In studies of RNA secondary structure and RNA-protein interactions, RNA splicing

Consensus promoter sequence:
SP6: ATTTAGGTGACACTATAGAAGNG

phi29 DNA Polymerase (10 U/µL) (Thermo Scientific™)

Thermo Scientific phi29 DNA Polymerase is a highly processive polymerase (up to more than 70 kb) featuring strong strand displacement activity, which allows for highly efficient isothermal DNA amplification. phi29 DNA Polymerase also possesses a 3'→5' exonuclease (proofreading) activity acting preferentially on single-stranded DNA or RNA. Therefore 3'-modified primers are highly recommended.

Highlights

• Highest processivity and strand displacement activity among known DNA polymerases – more than 70 kb long DNA stretches can be synthesized
• Highly accurate DNA synthesis
• Extremely high yields of amplified DNA even from minute amounts of template
• Amplification products can be directly used in downstream applications (PCR, restriction digestion, SNP genotyping, etc.)

Applications

• Rolling circle amplification (RCA): generation of periodic DNA nanotemplates
• Multiple displacement amplification (MDA)
• Unbiased amplification of whole genome (WGA, see Figure 1 in Supporting Data):
• amplification of DNA for SNP and STR detection
• cell-free amplification of DNA from single cells
• pathogenic organisms or metagenomes
• amplification of DNA from filter paper blood spot samples
• DNA template preparation for sequencing
• Protein-primed DNA amplification
• In situ genotyping with padlock probes
• Recombination based-cloning
• Cell-free cloning of lethal DNA
• RNA-primed DNA amplification

Note

Addition of Pyrophosphatase to the reaction mixture with phi29 DNA Polymerase may enhance DNA synthesis.

Use of this enzyme in certain applications may be covered by patents and may require a license.

Klenow Fragment (10 U/µL) (Thermo Scientific™)

Thermo Scientific Klenow Fragment is the large fragment of DNA polymerase I. It exhibits 5'→3' polymerase activity and 3'→5' exonuclease (proofreading) activity, but lacks 5'→3' exonuclease activity of DNA polymerase I.

Highlights

• Incorporates modified nucleotides (e.g., Cy3-, Cy5-, aminoallyl-, biotin-, digoxigenin- and fluorescently-labeled nucleotides)
• Active in restriction enzyme, PCR, RT, and T4 DNA Ligase buffers

Applications
• DNA blunting by fill-in 5'-overhangs
• Random-primed DNA labeling
• Labeling by fill-in 5'-overhangs of dsDNA
• DNA sequencing by the Sanger method
• Site-specific mutagenesis of DNA with synthetic oligonucleotides
• Second strand synthesis of cDNA

T3 RNA Polymerase (20 U/µL) (Thermo Scientific™)

Thermo Scientific Bacteriophage T3 RNA polymerase is a DNA-dependent RNA polymerase with strict specificity for its respective double-stranded promoters. It catalyzes the 5'→3' synthesis of RNA on either single-stranded DNA or double-stranded DNA downstream from it promoter and is able to incorporate modified nucleotide.

Highlights

Incorporates modified nucleotides (e.g., aminoallyl-, biotin-, fluorescein-, digoxigenin-labeled nucleotides)

Applications

• Synthesis of unlabeled and labeled RNA that can be used:
• For hybridization, in vitro RNA translation
• As aRNA, siRNA, substrate in RNase protection assays, template for genomic DNA sequencing
• In studies of RNA secondary structure and RNA-protein interactions, RNA splicing

Note

Consensus promoter sequence:
T3: AATTAACCCTCACTAAAGGGAGA
The position in bold (+1) indicates the first nucleotide incorporated into RNA during transcription. Only bases at this position through +3 are critical for transcription, and they must be a G and a purine base, respectively.

DNA Polymerase I (Invitrogen™)

DNA Polymerase I is a DNA polymerase with 5´→3´ and 3´→5´ exodeoxyribonuclease activities. DNA Polymerase I also incorporates biotinylated nucleotides.

Applications—DNase I-dependent nick translation, second-strand synthesis in cDNA cloning, fill-in of 5´ overhangs
Source—purified from E. coli expressing the DNA Polymerase I gene on a plasmid

Performance and quality testing

Endodeoxyribonuclease assay; efficiency of DNase I-dependent nick translation determined.

Unit definition

One unit incorporates 10 nmol of total deoxyribonucleotide into acid-precipitable material in 30 min at 37°C using template/primer.

Unit reaction conditions

50 mM potassium phosphate (pH 7.0), 6.7 mM MgCl2 , 1 mM 2-mercaptoethanol, 80 µg/mL template/primer, 32 µM dTTP, 69 nM [3H]dTTP, and enzyme in 100 µL for 30 min at 37°C.

EquiPhi29™ DNA Polymerase (Thermo Scientific™)

Thermo Scientific EquiPhi29 DNA Polymerase is a proprietary phi29 DNA Polymerase mutant developed through in vitro protein evolution. This enzyme is significantly improved over phi29 DNA Polymerase in protein thermostability, reaction speed, product yield, and amplification bias, while retaining all the benefits of the wild-type enzyme, including high processivity (more than 70 kb), strong strand displacement activity, and 3'→5' exonuclease (proofreading) activity acting preferentially on single-stranded DNA or RNA. For this reason exo-resistant random primers are recommended.

Highlights include:
• Lowest amplification bias offered in the market
• Extremely high yields of amplified DNA, even from minute amounts of template
• Highly accurate DNA synthesis in shorter time

Applications:
• Unbiased whole genome amplification (WGA) using a variety of sample types:
   –DNA from single cells
   –Uncultured microbial cells and viral particles
   –Pathogenic organisms or metagenomes
   –DNA for SNP and STR detection
• Rolling circle amplification (RCA)
• Protein-primed DNA amplification
• Cell-free cloning of lethal DNA
• In situ genotyping with padlock probes
• RNA-primed DNA amplification

Note: addition of pyrophosphatase to the reaction mixture with EquiPhi29 DNA Polymerase may further enhance DNA synthesis.

T3 RNA Polymerase, HC (≥100 U/µL) (Thermo Scientific™)

Thermo Scientific Bacteriophage T3 RNA polymerase is a DNA-dependent RNA polymerase with strict specificity for its respective double-stranded promoters. It catalyzes the 5'→3' synthesis of RNA on either single-stranded DNA or double-stranded DNA downstream from it promoter and is able to incorporate modified nucleotide.

Highlights

Incorporates modified nucleotides (e.g., aminoallyl-, biotin-, fluorescein-, digoxigenin-labeled nucleotides)

Applications

• Synthesis of unlabeled and labeled RNA that can be used:
• For hybridization, in vitro RNA translation
• As aRNA, siRNA, substrate in RNase protection assays, template for genomic DNA sequencing
• In studies of RNA secondary structure and RNA-protein interactions, RNA splicing

Note

Consensus promoter sequence:
T3: AATTAACCCTCACTAAAGGGAGA
The position in bold (+1) indicates the first nucleotide incorporated into RNA during transcription. Only bases at this position through +3 are critical for transcription, and they must be a G and a purine base, respectively.

Klenow Fragment, LC (2 U/µL) (Thermo Scientific™)

Thermo Scientific Klenow Fragment is the large fragment of DNA polymerase I. It exhibits 5'→3' polymerase activity and 3'→5' exonuclease (proofreading) activity, but lacks 5'→3' exonuclease activity of DNA polymerase I.

Highlights

• Incorporates modified nucleotides (e.g., Cy3-, Cy5-, aminoallyl-, biotin-, digoxigenin- and fluorescently-labeled nucleotides)
• Active in restriction enzyme, PCR, RT, and T4 DNA Ligase buffers

Applications
• DNA blunting by fill-in 5'-overhangs
• Random-primed DNA labeling
• Labeling by fill-in 5'-overhangs of dsDNA
• DNA sequencing by the Sanger method
• Site-specific mutagenesis of DNA with synthetic oligonucleotides
• Second strand synthesis of cDNA

T7 RNA Polymerase (20 U/µL) (Thermo Scientific™)

Thermo Scientific Bacteriophage T7 RNA polymerase is a DNA-dependent RNA polymerase with strict specificity for its respective double-stranded promoters. It catalyzes the 5'→3' synthesis of RNA on either single-stranded DNA or double-stranded DNA downstream from it promoter.

Highlights

• Incorporates modified nucleotides (e.g., aminoallyl-, biotin-, fluorescein-, digoxigenin-labeled nucleotides)

Applications

Synthesis of unlabeled and labeled RNA that can be used:

• For hybridization, in vitro RNA translation
• As aRNA, siRNA, substrate in RNase protection assays, template for genomic DNA sequencing
• In studies of RNA secondary structure and RNA-protein interactions, RNA splicing

Consensus promoter sequence:
T7: TAATACGACTCACTATAGGGAGA

Bsm DNA Polymerase, large fragment (8 U/µL) (Thermo Scientific™)

Thermo Scientific Bsm DNA Polymerase, Large Fragment, is an equivalent to Bst DNA polymerase, which catalyzes 5'→3' synthesis of DNA and lacks 5'→3' and 3'→5' exonuclease activities. Bsm DNA Polymerase, Large Fragment, is a portion of DNA polymerase of Bacillus smithii that has a strong strand displacement activity and is active in a wide range of temperatures from 30°C to 63°C, with an optimum of activity at 60°C. It is an enzyme with high functional similarity to Bst DNA Polymerase, Large Fragment, and can replace it in most applications.

Highlights
• Thermophilic DNA polymerase with strong strand displacement activity

Applications
• Isothermal DNA amplification by the method of:
    --Loop-mediated isothermal amplification (LAMP)
    --Whole genome amplification (WGA)
    --Ramification amplification (RAM)
• Random-primed DNA labeling
• Labeling by fill-in 5'-overhangs of dsDNA

Note: Not suitable for use in PCR.

DNA Polymerase I, Large (Klenow) Fragment (Invitrogen™)

DNA Polymerase I, Large (Klenow) Fragment is a DNA polymerase enzyme that lacks the 5' to 3' exonuclease activity of intact DNA Polymerase I, but does exhibit the 5' to 3' DNA polymerase and 3' to 5' exonuclease activities.

Applications:
Fill-in of 5´ overhangs (1). Synthesis of probes by random primers labeling method (2). Sequencing single- and double-stranded DNA (3). Site-directed mutagenesis.

Source:
Purified from E. coli expressing the Klenow fragment on a plasmid.

Performance and Quality Testing:
SDS-PAGE purity; single-stranded and double-stranded endodeoxyribonuclease and self-priming assays; performance evaluated in fill-in reaction.

Unit Definition:
One unit incorporates 10 nmol of total deoxyribonucleotide into acid-precipitable material in 30 min. at 37°C using a template•primer.

Poly(A) Polymerase, Yeast (Thermo Scientific™)

Poly(A) Polymerase catalyses the addition of adenosine residues onto the 3' ends of RNA. It can be used to add poly(A) tails to RNA in the first step of cloning. The reaction requires Mn2+ or Mg2+, ATP as substrate, and any RNA containing 3' hydroxyl termini as primer. Substitution of cordycepin-5'-triphosphate (3'-dATP) for ATP results in addition of a single 3'-dA residue to the ends of the RNA, a useful technique for labeling RNA at the 3' end.

In comparative studies, yeast poly(A) polymerase works more efficiently than E. coli poly(A) polymerase for RNA oligonucleotide-labeling and poly(A) tailing. Shorter incubation times are required for the yeast enzyme and it is found to label both long and short substrates equally well. Poly(A) Polymerase is recommended over T4 RNA Ligase for 3'-end labeling of long RNA molecules.

*Note: Various modified nucleotides can also be used to label the 3' end of RNA using Yeast Poly(A) Polymerase.

Purity:
Ribonuclease free

Storage Buffer:
20 mM Tris-HCl (pH 8.0), 50 mM KCl, 0.5 mM DTT, 50% glycerol.

Assay Conditions:
2 5mM Tris-HCl (pH 7.0), 40 mM KCl, 0.5 mM MnCl2, 0.05 mM EDTA, 0.5 mM DTT, 0.2 mg/mL BSA, 10% glycerol, 3.3 µM radiolabeled ATP, 0.5mM ATP, 6.5 µg poly(A) (~100 bases), poly(A) polymerase. After incubation at 37°C for 10 min, acid insoluble radioactivity is determined.

Unit Definition:
One unit equals 15 pmol/min AMP incorporated into (riboA)15 at 37°C.

Concentration:
600 units/µL

Functional Test:
3' -end labeling of a ribonucleotide with cordycepin-5'-triphosphate.

Functionally Tested 5X Poly(A) Polymerase Reaction Buffer (1 mL included, PN 74226):
100 mM Tris-HCl, pH 7.0, 3.0 mM MnCl2, 0.1 mM EDTA, 1mM DTT, 500 µg/mL acetylated BSA, 50% glycerol.

Applications:
  1.Addition of poly(A) tails to RNA.
  2.Labeling the 3' ends of RNA.

Source:
E. coli strain containing an overproducing clone of Yeast Poly(A) Polymerase.


Poly(A) Polymerase (cloned) 2 U/μL (Invitrogen™)

Ambion® Poly(A) Polymerase catalyzes the addition of adenosine to the 3' end of RNA in a sequence-independent fashion. The enzyme can be used to append radiolabeled ATP to the 3' end of RNA molecules to generate labeled RNAs. One tube containing 80 U (2 U/ µL), 5X Poly(A) Polymerase Buffer, and 25 mM MnCl2 are provided. The enzyme can be used in conjunction with terminal transferase, reverse transcriptase, and thermostable polymerase to clone RNAs of unknown sequence.

Unit Definition:
One unit is the amount of enzyme required to incorporate 1 nmol of AMP into acid-insoluble material in 10 min at 37°C.