Shop All DNA⁄RNA Polymerases

T4 DNA Polymerase (5 U/µL) (Thermo Scientific™)

Thermo Scientific T4 DNA Polymerase is a template-dependent DNA polymerase that catalyzes 5'-3' synthesis from primed single-stranded DNA. The enzyme has a 3'-5' exonuclease activity, but lacks 5'-3' exonuclease activity.

Highlights

Stronger 3'-5' exonuclease activity on single-stranded than on double-stranded DNA and greater (more than 200 times) than DNA polymerase I, E. coli,and Klenow fragment
• Active in Thermo Scientific restriction enzyme, PCR, RT and T4 DNA Ligase buffers

Applications

• Blunting of DNA ends: fill-in of 5'-overhangs or/and removal of 3'-overhangs(see​ References1, 2)
• Blunting of PCR products with 3'-dA overhangs
• Synthesis of labeled DNA probes by the replacement reaction(see​ Reference3)
• Oligonucleotide-directed site-specific mutagenesis(see​ Reference4)
• Ligation-independent cloning of PCR products

Poly(A) Polymerase, Yeast (Thermo Scientific™)

Poly(A) Polymerase catalyses the addition of adenosine residues onto the 3' ends of RNA. It can be used to add poly(A) tails to RNA in the first step of cloning. The reaction requires Mn2+ or Mg2+, ATP as substrate, and any RNA containing 3' hydroxyl termini as primer. Substitution of cordycepin-5'-triphosphate (3'-dATP) for ATP results in addition of a single 3'-dA residue to the ends of the RNA, a useful technique for labeling RNA at the 3' end.

In comparative studies, yeast poly(A) polymerase works more efficiently than E. coli poly(A) polymerase for RNA oligonucleotide-labeling and poly(A) tailing. Shorter incubation times are required for the yeast enzyme and it is found to label both long and short substrates equally well. Poly(A) Polymerase is recommended over T4 RNA Ligase for 3'-end labeling of long RNA molecules.

*Note: Various modified nucleotides can also be used to label the 3' end of RNA using Yeast Poly(A) Polymerase.

Purity:
Ribonuclease free

Storage Buffer:
20 mM Tris-HCl (pH 8.0), 50 mM KCl, 0.5 mM DTT, 50% glycerol.

Assay Conditions:
2 5mM Tris-HCl (pH 7.0), 40 mM KCl, 0.5 mM MnCl2, 0.05 mM EDTA, 0.5 mM DTT, 0.2 mg/mL BSA, 10% glycerol, 3.3 µM radiolabeled ATP, 0.5mM ATP, 6.5 µg poly(A) (~100 bases), poly(A) polymerase. After incubation at 37°C for 10 min, acid insoluble radioactivity is determined.

Unit Definition:
One unit equals 15 pmol/min AMP incorporated into (riboA)15 at 37°C.

Concentration:
600 units/µL

Functional Test:
3' -end labeling of a ribonucleotide with cordycepin-5'-triphosphate.

Functionally Tested 5X Poly(A) Polymerase Reaction Buffer (1 mL included, PN 74226):
100 mM Tris-HCl, pH 7.0, 3.0 mM MnCl2, 0.1 mM EDTA, 1mM DTT, 500 µg/mL acetylated BSA, 50% glycerol.

Applications:
  1.Addition of poly(A) tails to RNA.
  2.Labeling the 3' ends of RNA.

Source:
E. coli strain containing an overproducing clone of Yeast Poly(A) Polymerase.


T7 DNA Polymerase (10 U/µL) (Thermo Scientific™)

Thermo Scientific T7 DNA Polymerase, a template dependent DNA polymerase, catalyzes DNA synthesis in the 5'→3' direction. It is a highly processive DNA polymerase allowing continuous synthesis of long stretches of DNA. The enzyme also exhibits a high 3'→5' exonuclease activity towards single- and double-stranded DNA.

Highlights

Strong 3'→5' exonuclease activity, approximately 1000-fold greater than Klenow Fragment
Active in restriction enzyme buffers

Applications

• Purification of covalently closed circular DNA by removal of residual genomic DNA
• Primer extension reactions on long templates (see​ Reference 1)
• DNA 3'-end labeling (see​ Reference 1)
• Strand extensions in site-directed mutagenesis
• Fill-in blunting of 5'-overhang DNA
• Second strand synthesis of cDNA
In situ detection of DNA fragmentation associated with apoptosis

Note

Assays at 37°C require only short incubation times .

phi29 DNA Polymerase (10 U/µL) (Thermo Scientific™)

Thermo Scientific phi29 DNA Polymerase is a highly processive polymerase (up to more than 70 kb) featuring strong strand displacement activity, which allows for highly efficient isothermal DNA amplification. phi29 DNA Polymerase also possesses a 3'→5' exonuclease (proofreading) activity acting preferentially on single-stranded DNA or RNA. Therefore 3'-modified primers are highly recommended.

Highlights

• Highest processivity and strand displacement activity among known DNA polymerases – more than 70 kb long DNA stretches can be synthesized
• Highly accurate DNA synthesis
• Extremely high yields of amplified DNA even from minute amounts of template
• Amplification products can be directly used in downstream applications (PCR, restriction digestion, SNP genotyping, etc.)

Applications

• Rolling circle amplification (RCA): generation of periodic DNA nanotemplates
• Multiple displacement amplification (MDA)
• Unbiased amplification of whole genome (WGA, see Figure 1 in Supporting Data):
• amplification of DNA for SNP and STR detection
• cell-free amplification of DNA from single cells
• pathogenic organisms or metagenomes
• amplification of DNA from filter paper blood spot samples
• DNA template preparation for sequencing
• Protein-primed DNA amplification
• In situ genotyping with padlock probes
Recombination based-cloning
• Cell-free cloning of lethal DNA
• RNA-primed DNA amplification

Note

Addition of Pyrophosphatase to the reaction mixture with phi29 DNA Polymerase may enhance DNA synthesis.

Use of this enzyme in certain applications may be covered by patents and may require a license.

Bsm DNA Polymerase, large fragment (8 U/µL) (Thermo Scientific™)

Thermo Scientific Bsm DNA Polymerase, Large Fragment, is an equivalent to Bst DNA polymerase, which catalyzes 5'→3' synthesis of DNA and lacks 5'→3' and 3'→5' exonuclease activities. Bsm DNA Polymerase, Large Fragment, is a portion of DNA polymerase of Bacillus smithii that has a strong strand displacement activity and is active in a wide range of temperatures from 30°C to 63°C, with an optimum of activity at 60°C. It is an enzyme with high functional similarity to Bst DNA Polymerase, Large Fragment, and can replace it in most applications.

Highlights
• Thermophilic DNA polymerase with strong strand displacement activity

Applications
• Isothermal DNA amplification by the method of:
    --Loop-mediated isothermal amplification (LAMP)
    --Whole genome amplification (WGA)
    --Ramification amplification (RAM)
• Random-primed DNA labeling
• Labeling by fill-in 5'-overhangs of dsDNA

Note: Not suitable for use in PCR.

Sequenase Version 2.0 DNA Sequencing Kit (Applied Biosystems™)

The Sequenase™ Version 2.0 DNA Sequencing Kit features Sequenase Version 2.0 DNA Polymerase, the standard for high quality manual DNA sequencing. Sequenase Version 2.0 DNA polymerase is a genetically engineered form of T7 DNA polymerase which retains extraordinary polymerase activity with virtually no 3'→5' exonuclease activity. It is highly processive, able to effectively incorporate nucleotide analogs for sequencing (dideoxy NTPs, α-thio dATP, dITP, 7-deaza-dGTP, etc.) and is not easily impeded by template secondary structure. The kit includes all the reagents necessary to achieve high quality results. Use of the specially formulated buffers and mixes included in the kit will maximize yield of sequence information.

Flexible Labeling
The kit can be used for either internal labeling with α-labeled dNTPs or with 5' end-labeled primers.

Resolve Gel Compressions with dITP Nucleotide Mixes
The substitution of dITP (deoxyinosine triphosphate) for dGTP in the reaction mix eliminates the secondary structures that produce gel compressions. dITP forms fewer H-bonds with dCTP than does dGTP, so product is more readily denatured during gel electrophoresis. Hence, sequence data is free from gel-based compression artifacts and results are more accurate.

Emphasize Sequence Close to Primers with Mn Buffer
Manganese (Mn) is added to emphasize sequence close to the primer, which may be weak if insufficient DNA template is used. Mn++ increases the incorporation rate of dideoxynucleotides relative to deoxynucleotides. Thus, termination occurs earlier and more sequence is visible close to the primer.

Increase Read Length with Sequence Extending Mixes
These mixes enable chain terminations to be extended to more than 3,000 bases from the primer. The use of these mixes provides a simple method to further extend the range of sequence, if needed. Keep in mind that this degree of extension can reach well beyond the limits of any electrophoresis gel resolution, yet use of the mixes when combined with short and long gel runs can increase overall sequence yield.

Eliminate Weak Bands with Pyrophosphatase
Occasionally, weak bands may occur with prolonged reaction times (greater than 5 min), or when dITP is used in the sequencing reaction. The addition of pyrophosphatase can prevent weak band intensities brought on by sequence-specific pyrophosphorolysis catalyzed by the polymerase.

Convenient Enzyme Storage with Glycerol Enzyme Dilution Buffer
Sequenase DNA polymerase can be pre-diluted to a working concentration for storage of the enzyme in this form. This eliminates the necessity of diluting the polymerase prior to each sequencing reaction. Also, the addition of glycerol enhances the stability of the enzyme in sequencing reactions. Note: Pre-dilution of the polymerase with this buffer results in higher glycerol concentration in the sequencing reaction. A Glycerol Tolerant Gel (GTG) Buffer must be used in the sequencing gel and buffer chambers to eliminate glycerol-induced distortion of bands at approximately 350 to 600 bases beyond the primer. If this region is beyond your region of interest, Tris-Borate-EDTA (TBE) Buffer may be used.

Kit Components:
Sequenase Version 2.0 DNA Polymerase
Inorganic Pyrophosphatase
Enzyme Dilution Buffer
Glycerol Enzyme Dilution Buffer
Sequenase Reaction Buffer (5X)
Dithiothreitol Solution
Mn Buffer

Control DNA M13 mp18
Primer (-40 Universal)
Labeling Mix (dGTP, 5X)
ddGTP Termination Mix (for dGTP)
ddATP Termination Mix (for dGTP)
ddTTP Termination Mix (for dGTP)
ddCTP Termination Mix (for dGTP)
Sequencing Extending Mix (for dGTP)

Labeling Mix (dITP, 5X)
ddGTP Termination Mix (for dITP)
ddATP Termination Mix (for dITP)
ddTTP Termination Mix (for dITP)
ddCTP Termination Mix (for dITP)
Sequence Extending Mix (for dITP)

Stop Solution
Protocol Book

This kit and all the enclosed reagents should be stored frozen at -20°C (NOT in a frost-free freezer). Keep all reagents on ice when removed from storage for use. Sequenase Version 2.0 enzyme must be stored at -20°C. Never store Sequenase enzyme in a frost-free freezer since the temperature rises above 0°C daily. If enzyme dilution buffer (no glycerol) is to be used, only dilute the amount of enzyme which is to be used that day. Dilute into ice-cold buffer and keep on ice until use.

References:
TABOR, S. AND RICHARDSON C. C. (1989) J. Biol. Chem. 264, 6447-6458.
FULLER, C. W. (1989) Comments 16, No. 3, United States Biochemical Corp., Cleveland, OH.
TABOR, S. AND RICHARDSON, C. C. (1989) Proc. Nat. Acad. Sci. USA 86, 4076-4080.
RUAN, C. C., SAMOLS, S. B. AND FULLER, C. W. (1990) Comments 17, No. 1, United States Biochemical Corp., Cleveland, OH.
TABOR, S. AND RICHARDSON C. C. (1990) J. Biol. Chem. 265, 8322-8328.
TABOR, S. AND RICHARDSON, C. C. (1989) Proc. Nat. Acad. Sci. USA 84, 4767-4771.
PISA-WILLIAMSON, D. AND FULLER, C. W. (1992) Comments 19, No. 2, United States Biochemical Corp., Cleveland, OH.

Klenow Fragment, exo– (5 U/µL) (Thermo Scientific™)

Thermo Scientific Klenow Fragment, exo-, is the large fragment of DNA polymerase I . It exhibits 5'→3' polymerase activity, but lacks the 3'→5' and 5'→3' exonuclease activities of DNA Polymerase I. The 3'→5' exonuclease activity of the enzyme is eliminated by mutations in the 3'→5'-exonuclease active site.

Highlights

• Lacks 3'→5' exonuclease activity
• Incorporates modified nucleotides (e.g., Cy3-, Cy5-, fluorescein-, rhodamine-, aminoallyl-, biotin-labeled nucleotides)
• Active in restriction enzyme, PCR, and RT buffers

Applications
• Random-primed DNA labeling
• Labeling by fill-in 5'-overhangs of dsDNA
• Strand displacement amplification (SDA)
• DNA sequencing by the Sanger method

Note

Klenow Fragment, exo- is not recommended for DNA blunting reactions prior to DNA ligation since it frequently adds one or more extra nucleotides to the 3'-terminus of blunt-end DNA substrates in a non-template directed fashion.

DNA Polymerase I (10 U/µL) (Thermo Scientific™)

Thermo Scientific DNA Polymerase I, a template-dependent DNA polymerase, catalyzes 5'→3' synthesis of DNA. The enzyme also exhibits 3'→5' exonuclease (proofreading) activity, 5'→3' exonuclease activity, and ribonuclease H activity.

Highlights

• Incorporates modified nucleotides (e.g. biotin-, digoxigenin-, aminoallyl-, fluorescently-labeled nucleotides)
• Active in multiple buffers, including restriction enzyme, PCR, and RT buffers

Applications

• DNA labeling by nick-translation in conjunction with DNase
• Second-strand synthesis of cDNA in conjunction with RNase H

Klenow Fragment, LC (2 U/µL) (Thermo Scientific™)

Thermo Scientific Klenow Fragment is the large fragment of DNA polymerase I. It exhibits 5'→3' polymerase activity and 3'→5' exonuclease (proofreading) activity, but lacks 5'→3' exonuclease activity of DNA polymerase I.

Highlights

• Incorporates modified nucleotides (e.g., Cy3-, Cy5-, aminoallyl-, biotin-, digoxigenin- and fluorescently-labeled nucleotides)
• Active in restriction enzyme, PCR, RT, and T4 DNA Ligase buffers

Applications
• DNA blunting by fill-in 5'-overhangs
• Random-primed DNA labeling
• Labeling by fill-in 5'-overhangs of dsDNA
• DNA sequencing by the Sanger method
• Site-specific mutagenesis of DNA with synthetic oligonucleotides
• Second strand synthesis of cDNA

Sequenase Version 2.0 DNA Polymerase (Applied Biosystems™)

Description:
Sequenase™ Version 2.0 DNA Polymerase is a genetically engineered form of T7 DNA polymerase. Unlike the wild-type enzyme it has virtually no 3'→5' exonuclease activity. Sequenase Version 2.0 is highly processive, incorporates nucleotide analogs (dlTP, thio-dNTPs, dideoxy-NTPs, etc.), is not impeded by secondary structures, and can carry out strand displacement synthesis. It is an excellent enzyme for dideoxy-sequencing, and is useful in other applications, especially where the absence of associated exonuclease activity is desirable.Sequenase Version 2.0 has two subunits, one is the E. coli protein thioredoxin (MW 12,000) and the other is a genetically engineered version of bacteriophage T7 gene 5 protein (MW 76,000). The genetic changes in this subunit (a deletion of 28 amino acids accomplished by in vitro mutagenesis) eliminate all measurable exonuclease activity without changing the DNA polymerase activity.

Properties:
Molecular Weight: Consists of two subunits, modified T7 gene 5 protein (76 kDa) and E. coli
Thioredoxin (12 kDa)
Optimum pH: 7.5
Optimum Temperature: 37°C
Requirements for Divalent Cation: Mg2+, Mn2+

Purity:
Greater than 95% pure as determined by SDS-PAGE.Tested for contaminating double- and single-stranded endonucleases and exonucleases.

Storage Buffer:
20mM potassium phosphate (pH 7.4), 1mM DTT, 0.1mM EDTA, 50% glycerol.

Assay Conditions:
The reaction mixture (100 µL) contains 40mM Tris-HCl (pH 7.5), 10mM MgCl2, 5mM DTT, 0.3mM dNTPs, and 5 µg M13mp18 pre-annealed to 5 pmol M13 universal primer. The enzyme is added to the pre-warmed (37 °C) reaction mixture; incubation is at 37 °C for 1 min.

Unit Definition:
One unit of enzyme catalyzes the incorporation of 1 nmol of nucleotide into acid insoluble form in 30 sec at 37 °C.

Concentration:
13 units/µL

Functional Test:
DNA sequencing with the Sequenase Version 2.0 DNA Sequencing Kit (PN 70770).

Functionally Tested 5X Sequenase Reaction Buffer (1 ml included, PN 70702):
200mM Tris-HCl (pH 7.5), 100mM MgCl2, 250mM NaCl

Sequenase Dilution Buffer (1 ml included, PN 70765):
10mM Tris-HCl (pH 7.5), 5mM DTT, 0.1mM EDTA.

References:
Tabor, S. and Richardson, C. C. (1989) J. Biol. Chem. 264, 6447-6458.
Wang, D., Coscoy, L., Zylberberg, M., Avila, P. C., Boushey, H. A., Ganem, D. and DeRisi, J. L. (2002) Proc Natl. Acad. Sci. USA, 99, 15687-15692.
Paris, M. (1992) Comments 18, (No. 3), United States Biochemical Corporation, Cleveland, Ohio.
Tabor, S. and Richardson, C. C. (1987) Proc.Natl. Acad Sci. USA 84, 4767-4771.
Tabor, S. and Richardson, C. C. (1989) Proc.Natl. Acad. Sci. USA 86, 4076-4080.

T4 DNA Polymerase (Invitrogen™)

T4 DNA Polymerase is a DNA polymerase that has a 3´-exodeoxyribonuclease activity, but lacks 5´a3´ exodeoxyribonuclease activity. A T4 DNA Polymerase Technical Bulletin is available.

Applications:
Labeling double-stranded linear DNA by replacement synthesis (1). Oligonucleotide-directed, site-specific mutagenesis (2). 3´ end-labeling of double-stranded DNA (3). Polishing both 5´ or 3 overhangs to make blunt ends (4).

Source:
Purified from E. coli expressing the T4 DNA Polymerase gene on a plasmid.

Performance and Quality Testing:
Single- and double-stranded endodeoxyribonuclease and phosphatase assays; exodeoxyribonuclease and polymerase activities tested.

Unit Definition:
One unit incorporates 10 nmol of total deoxyribonucleotide into acid-precipitable material in 30 min. at 37°C using DNase I-nicked DNA as template•primer.

Unit Reaction Conditions:
50 mM glycine-NaOH (pH 8.8), 16.6 mM (NH4)2SO4 , 6 mM MgCl2 , 6.5 µM EDTA, 10 mM 2-mercaptoethanol, 0.165 mg/ml BSA, 1.6 mg/ml DNase I-nicked salmon testes DNA, 0.33 mM dCTP, 0.33 mM dATP, 0.33 mM dGTP, 0.33 mM dTTP, 76 nM [3H]dTTP, and enzyme in 0.1 ml for 30 min. at 37°C.

EquiPhi29™ DNA Polymerase (Thermo Scientific™)

Thermo Scientific EquiPhi29 DNA Polymerase is a proprietary phi29 DNA Polymerase mutant developed through in vitro protein evolution. This enzyme is significantly improved over phi29 DNA Polymerase in protein thermostability, reaction speed, product yield, and amplification bias, while retaining all the benefits of the wild-type enzyme, including high processivity (more than 70 kb), strong strand displacement activity, and 3'→5' exonuclease (proofreading) activity acting preferentially on single-stranded DNA or RNA. For this reason exo-resistant random primers are recommended.

Highlights include:
• Lowest amplification bias offered in the market
• Extremely high yields of amplified DNA, even from minute amounts of template
• Highly accurate DNA synthesis in shorter time

Applications:
• Unbiased whole genome amplification (WGA) using a variety of sample types:
   –DNA from single cells
   –Uncultured microbial cells and viral particles
   –Pathogenic organisms or metagenomes
   –DNA for SNP and STR detection
• Rolling circle amplification (RCA)
• Protein-primed DNA amplification
• Cell-free cloning of lethal DNA
• In situ genotyping with padlock probes
• RNA-primed DNA amplification

Note: addition of pyrophosphatase to the reaction mixture with EquiPhi29 DNA Polymerase may further enhance DNA synthesis.

T7 RNA Polymerase (Invitrogen™)

T7 RNA Polymerase is a DNA-dependent RNA polymerase that has a high specificity for bacteriophage T7 promoter sequences. The enzyme synthesizes large quantities of RNA from DNA inserted into a transcription vector downstream from a T7 promoter. A T7 RNA Polymerase technical bulletin is available.

Application:
Synthesis of labeled and unlabeled RNA transcripts (1).

Source:
Purified from E. coli expressing the T7 RNA Polymerase gene on a plasmid.

Performance and Quality Testing:
3´ and 5´ exodeoxyribonuclease, ribonuclease, and DNA nicking assays; performance in a
transcription reaction.

Unit Definition:
One unit hydrolyzes 1 nmol of ribonucleotide into acid-precipitable material in 1 h at 37°C using a T7 transcription
vector as template.

Unit Reaction Conditions:
40 mM Tris-HCl (pH 8.0), 25 mM NaCl, 8 mM MgCl2 , 2 mM spermidine-(HCl)3 , 5 mM DTT, 0.4 mM ATP, 0.4 mM CTP, 0.4 mM GTP, 0.4 mM UTP, 1 µCi [3H]GTP, 1 µg Sph I-cut pT7L13, and enzyme in 50 µl for 10 min. at 37°C.

DNA Polymerase I (Invitrogen™)

DNA Polymerase I is a DNA polymerase with 5´→3´ and 3´→5´ exodeoxyribonuclease activities. DNA Polymerase I also incorporates biotinylated nucleotides.

Applications—DNase I-dependent nick translation, second-strand synthesis in cDNA cloning, fill-in of 5´ overhangs
Source—purified from E. coli expressing the DNA Polymerase I gene on a plasmid

Performance and quality testing

Endodeoxyribonuclease assay; efficiency of DNase I-dependent nick translation determined.

Unit definition

One unit incorporates 10 nmol of total deoxyribonucleotide into acid-precipitable material in 30 min at 37°C using template/primer.

Unit reaction conditions

50 mM potassium phosphate (pH 7.0), 6.7 mM MgCl2 , 1 mM 2-mercaptoethanol, 80 µg/mL template/primer, 32 µM dTTP, 69 nM [3H]dTTP, and enzyme in 100 µL for 30 min at 37°C.

T3 RNA Polymerase, HC (≥100 U/µL) (Thermo Scientific™)

Thermo Scientific Bacteriophage T3 RNA polymerase is a DNA-dependent RNA polymerase with strict specificity for its respective double-stranded promoters. It catalyzes the 5'→3' synthesis of RNA on either single-stranded DNA or double-stranded DNA downstream from it promoter and is able to incorporate modified nucleotide.

Highlights

Incorporates modified nucleotides (e.g., aminoallyl-, biotin-, fluorescein-, digoxigenin-labeled nucleotides)

Applications

• Synthesis of unlabeled and labeled RNA that can be used:
• For hybridization, in vitro RNA translation
• As aRNA, siRNA, substrate in RNase protection assays, template for genomic DNA sequencing
• In studies of RNA secondary structure and RNA-protein interactions, RNA splicing

Note

Consensus promoter sequence:
T3: AATTAACCCTCACTAAAGGGAGA
The position in bold (+1) indicates the first nucleotide incorporated into RNA during transcription. Only bases at this position through +3 are critical for transcription, and they must be a G and a purine base, respectively.