Shop All DNA⁄RNA Polymerases

T4 DNA Polymerase (Invitrogen™)

T4 DNA Polymerase is a DNA polymerase that has a 3´-exodeoxyribonuclease activity, but lacks 5´a3´ exodeoxyribonuclease activity. A T4 DNA Polymerase Technical Bulletin is available.

Applications:
Labeling double-stranded linear DNA by replacement synthesis (1). Oligonucleotide-directed, site-specific mutagenesis (2). 3´ end-labeling of double-stranded DNA (3). Polishing both 5´ or 3 overhangs to make blunt ends (4).

Source:
Purified from E. coli expressing the T4 DNA Polymerase gene on a plasmid.

Performance and Quality Testing:
Single- and double-stranded endodeoxyribonuclease and phosphatase assays; exodeoxyribonuclease and polymerase activities tested.

Unit Definition:
One unit incorporates 10 nmol of total deoxyribonucleotide into acid-precipitable material in 30 min. at 37°C using DNase I-nicked DNA as template•primer.

Unit Reaction Conditions:
50 mM glycine-NaOH (pH 8.8), 16.6 mM (NH4)2SO4 , 6 mM MgCl2 , 6.5 µM EDTA, 10 mM 2-mercaptoethanol, 0.165 mg/ml BSA, 1.6 mg/ml DNase I-nicked salmon testes DNA, 0.33 mM dCTP, 0.33 mM dATP, 0.33 mM dGTP, 0.33 mM dTTP, 76 nM [3H]dTTP, and enzyme in 0.1 ml for 30 min. at 37°C.

Sequenase Version 2.0 DNA Polymerase (Applied Biosystems™)

Description:
Sequenase™ Version 2.0 DNA Polymerase is a genetically engineered form of T7 DNA polymerase. Unlike the wild-type enzyme it has virtually no 3'→5' exonuclease activity. Sequenase Version 2.0 is highly processive, incorporates nucleotide analogs (dlTP, thio-dNTPs, dideoxy-NTPs, etc.), is not impeded by secondary structures, and can carry out strand displacement synthesis. It is an excellent enzyme for dideoxy-sequencing, and is useful in other applications, especially where the absence of associated exonuclease activity is desirable.

Sequenase Version 2.0 has two subunits, one is the E. coli protein thioredoxin (MW 12,000) and the other is a genetically engineered version of bacteriophage T7 gene 5 protein (MW 76,000). The genetic changes in this subunit (a deletion of 28 amino acids accomplished by in vitro mutagenesis) eliminate all measurable exonuclease activity without changing the DNA polymerase activity.

Properties:
Molecular Weight: Consists of two subunits, modified T7 gene 5 protein (76 kDa) and E. coli
Thioredoxin (12 kDa)
Optimum pH: 7.5
Optimum Temperature: 37°C
Requirements for Divalent Cation: Mg2+, Mn2+

Purity:
Greater than 95% pure as determined by SDS-PAGE.Tested for contaminating double- and single-stranded endonucleases and exonucleases.

Storage Buffer:
20mM potassium phosphate (pH 7.4), 1mM DTT, 0.1mM EDTA, 50% glycerol.

Assay Conditions:
The reaction mixture (100 µL) contains 40mM Tris-HCl (pH 7.5), 10mM MgCl2, 5mM DTT, 0.3mM dNTPs, and 5 µg M13mp18 pre-annealed to 5 pmol M13 universal primer. The enzyme is added to the pre-warmed (37 °C) reaction mixture; incubation is at 37 °C for 1 min.

Unit Definition:
One unit of enzyme catalyzes the incorporation of 1 nmol of nucleotide into acid insoluble form in 30 sec at 37 °C.

Concentration:
13 units/µL

Functional Test:
DNA sequencing with the Sequenase Version 2.0 DNA Sequencing Kit (PN 70770).

Functionally Tested 5X Sequenase Reaction Buffer (1 ml included, PN 70702):
200mM Tris-HCl (pH 7.5), 100mM MgCl2, 250mM NaCl

Sequenase Dilution Buffer (1 ml included, PN 70765):
10mM Tris-HCl (pH 7.5), 5mM DTT, 0.1mM EDTA.

References:
Tabor, S. and Richardson, C. C. (1989) J. Biol. Chem. 264, 6447-6458.
Wang, D., Coscoy, L., Zylberberg, M., Avila, P. C., Boushey, H. A., Ganem, D. and DeRisi, J. L. (2002) Proc Natl. Acad. Sci. USA, 99, 15687-15692.
Paris, M. (1992) Comments 18, (No. 3), United States Biochemical Corporation, Cleveland, Ohio.
Tabor, S. and Richardson, C. C. (1987) Proc.Natl. Acad Sci. USA 84, 4767-4771.
Tabor, S. and Richardson, C. C. (1989) Proc.Natl. Acad. Sci. USA 86, 4076-4080.

DNA Polymerase I (10 U/µL) (Thermo Scientific™)

Thermo Scientific DNA Polymerase I, a template-dependent DNA polymerase, catalyzes 5'→3' synthesis of DNA. The enzyme also exhibits 3'→5' exonuclease (proofreading) activity, 5'→3' exonuclease activity, and ribonuclease H activity.

Highlights

• Incorporates modified nucleotides (e.g. biotin-, digoxigenin-, aminoallyl-, fluorescently-labeled nucleotides)
• Active in multiple buffers, including restriction enzyme, PCR, and RT buffers

Applications

• DNA labeling by nick-translation in conjunction with DNase
• Second-strand synthesis of cDNA in conjunction with RNase H

USB™ CycleSeq™ Thermostable DNA Polymerase (Applied Biosystems™)

USB™ CycleSeq™Thermostable DNA Polymerase is a thermostable, DNA polymerase that is exonuclease-free and incorporates ddNTPs with a marked level of efficiency over standard thermostable DNA polymerases. This allows for more even and easy-to-read sequence band patterns, making sequence anomalies easier to identify.

USB CycleSeq Thermostable DNA Polymerase can be substituted for ThermoSequenase DNA polymerase as both enzymes incorporate modified nucleotides (see Fig. 1).

CycleSeq DNA Polymerase, like Thermo Sequenase DNA Polymerase, includes Thermoplasma acidophilum inorganic pyrophosphatase (TAP). TAP is thermostable and converts pyrophosphate to orthophosphate, a useful feature during cycle sequencing reactions where pyrophosphates are produced.

USB CycleSeq Thermostable DNA Polymerase is useful for cycle sequencing (Sanger sequencing), as it produces sequence data with uniform band intensities which allows for longer and more accurate sequence reads. It is also useful for primer extension protocols during SNP genotyping.

Source:
Recombinant

Purity:
Greater than 95% pure as determined by SDS-PAGE.

Storage Buffer:
20 mM Tris-HCl, pH 8.5, 0.1 mM EDTA, 1 mM DTT, 100 mM KCl, 0.053 unit/µl Thermoplasma acidophilum inorganic pyrophosphatase, 50% glycerol, and stabilizers.

Assay Conditions:
The reaction mixture contains 25 mM TAPS, pH 9.3, 50 mM KCl, 2 mM MgCl2, 1 mM Β-ME, 200 µM dATP, 200 µM dGTP, 200 µM dTTP, 100 µM dCTP, 0.05 µL [α33P] dCTP (10 µCi/µL), 400 µg/mL activated DNA, and CycleSeq Thermostable DNA Polymerase. After incubation at 74deg;C for 10 minutes, acid-insoluble material is determined (50 µL reaction volume).

Unit Definition:
One unit of enzyme is defined as the amount of enzyme required to catalyze the incorporation of 10 nmol of dNTPs into acid-insoluble form in 30 minutes at 74°C under standard assay conditions.

Concentration:
32 units/µL

Functional test:
Functionally tested to meet or exceed the specifications for use in dye primer sequencing. Release specifications are based on sequence length, band intensity, and sequence quality. The sequence must also be free of background bands strong enough to interfere with sequence interpretation.

EquiPhi29™ DNA Polymerase Reaction Buffer (10X) (Thermo Scientific™)

This reaction buffer is for use with EquiPhi29 DNA Polymerase. Buffer is included with purchase of the polymerase, but additional buffer is made available here to help accommodate experimental needs.

Poly(A) Polymerase (cloned) 2 U/μL (Invitrogen™)

Ambion® Poly(A) Polymerase catalyzes the addition of adenosine to the 3' end of RNA in a sequence-independent fashion. The enzyme can be used to append radiolabeled ATP to the 3' end of RNA molecules to generate labeled RNAs. One tube containing 80 U (2 U/ µL), 5X Poly(A) Polymerase Buffer, and 25 mM MnCl2 are provided. The enzyme can be used in conjunction with terminal transferase, reverse transcriptase, and thermostable polymerase to clone RNAs of unknown sequence.

Unit Definition:
One unit is the amount of enzyme required to incorporate 1 nmol of AMP into acid-insoluble material in 10 min at 37°C.

DNA Polymerase I/DNase I (Invitrogen™)

DNA Polymerase I/DNase I is an optimized mixture of both enzymes for efficient nick translation of DNA.

Application:
Labeling DNA with either radiolabeled or biotinylated nucleotides.

Source:
DNase I is purified from bovine pancreas; DNA Polymerase I from E. coli λ lysogen NM 964.

Performance and Quality Testing:
Performance tested in nick translation reaction.

Unit Definition:
One unit of DNA Polymerase I in the absence of DNase I incorporates 10 nmol of total deoxyribonucleotide into acid-precipitable material in 30 min. at 37°C using a template•primer.

Unit Reaction Conditions:
50 mM potassium phosphate (pH 7.5), 6.7 mM MgCl2 , 1 mM 2-mercaptoethanol, 80 µg/ml template•primer, 32 µM dTTP, 69 nM [3H]dTTP, and enzyme in 100 µl for 30 min. at 37°C.

Ambion™ T7 RNA Polymerase, cloned, 200 U/µL (Invitrogen™)

This cloned high-purity Ambion® T7 RNA Polymerase has a high specificity for its promoter. The enzyme will transcribe large amounts of RNA from DNA sequences downstream of the promoter and show no cross talk between promoters. One tube containing 30,000 U at a concentration of 200 U/ µL is provided. Its high purity makes them ideal for synthesizing high specific activity RNA hybridization probes, biologically active mRNA, and antisense RNA. The RNA Polymerase is rigorously tested for contaminating nonspecific endonuclease, exonuclease, protease, and RNase activity. It is also tested for functionality with the MAXIscript® Kit at 20 U per reaction.

Unit Definition:
One unit of RNA Polymerase will catalyze the incorporation of 1 nmol of nucleoside triphosphate into acid-insoluble material in 60 min at 37°C.

Klenow Fragment, LC (2 U/µL) (Thermo Scientific™)

Thermo Scientific Klenow Fragment is the large fragment of DNA polymerase I. It exhibits 5'→3' polymerase activity and 3'→5' exonuclease (proofreading) activity, but lacks 5'→3' exonuclease activity of DNA polymerase I.

Highlights

• Incorporates modified nucleotides (e.g., Cy3-, Cy5-, aminoallyl-, biotin-, digoxigenin- and fluorescently-labeled nucleotides)
• Active in restriction enzyme, PCR, RT, and T4 DNA Ligase buffers

Applications
• DNA blunting by fill-in 5'-overhangs
• Random-primed DNA labeling
• Labeling by fill-in 5'-overhangs of dsDNA
• DNA sequencing by the Sanger method
• Site-specific mutagenesis of DNA with synthetic oligonucleotides
• Second strand synthesis of cDNA

Sequenase Version 2.0 DNA Sequencing Kit (Applied Biosystems™)

The Sequenase™ Version 2.0 DNA Sequencing Kit features Sequenase Version 2.0 DNA Polymerase, the standard for high quality manual DNA sequencing. Sequenase Version 2.0 DNA polymerase is a genetically engineered form of T7 DNA polymerase which retains extraordinary polymerase activity with virtually no 3'→5' exonuclease activity. It is highly processive, able to effectively incorporate nucleotide analogs for sequencing (dideoxy NTPs, α-thio dATP, dITP, 7-deaza-dGTP, etc.) and is not easily impeded by template secondary structure. The kit includes all the reagents necessary to achieve high quality results. Use of the specially formulated buffers and mixes included in the kit will maximize yield of sequence information.

Flexible Labeling
The kit can be used for either internal labeling with α-labeled dNTPs or with 5' end-labeled primers.

Resolve Gel Compressions with dITP Nucleotide Mixes
The substitution of dITP (deoxyinosine triphosphate) for dGTP in the reaction mix eliminates the secondary structures that produce gel compressions. dITP forms fewer H-bonds with dCTP than does dGTP, so product is more readily denatured during gel electrophoresis. Hence, sequence data is free from gel-based compression artifacts and results are more accurate.

Emphasize Sequence Close to Primers with Mn Buffer
Manganese (Mn) is added to emphasize sequence close to the primer, which may be weak if insufficient DNA template is used. Mn++ increases the incorporation rate of dideoxynucleotides relative to deoxynucleotides. Thus, termination occurs earlier and more sequence is visible close to the primer.

Increase Read Length with Sequence Extending Mixes
These mixes enable chain terminations to be extended to more than 3,000 bases from the primer. The use of these mixes provides a simple method to further extend the range of sequence, if needed. Keep in mind that this degree of extension can reach well beyond the limits of any electrophoresis gel resolution, yet use of the mixes when combined with short and long gel runs can increase overall sequence yield.

Eliminate Weak Bands with Pyrophosphatase
Occasionally, weak bands may occur with prolonged reaction times (greater than 5 min), or when dITP is used in the sequencing reaction. The addition of pyrophosphatase can prevent weak band intensities brought on by sequence-specific pyrophosphorolysis catalyzed by the polymerase.

Convenient Enzyme Storage with Glycerol Enzyme Dilution Buffer
Sequenase DNA polymerase can be pre-diluted to a working concentration for storage of the enzyme in this form. This eliminates the necessity of diluting the polymerase prior to each sequencing reaction. Also, the addition of glycerol enhances the stability of the enzyme in sequencing reactions. Note: Pre-dilution of the polymerase with this buffer results in higher glycerol concentration in the sequencing reaction. A Glycerol Tolerant Gel (GTG) Buffer must be used in the sequencing gel and buffer chambers to eliminate glycerol-induced distortion of bands at approximately 350 to 600 bases beyond the primer. If this region is beyond your region of interest, Tris-Borate-EDTA (TBE) Buffer may be used.

Kit Components:
Sequenase Version 2.0 DNA Polymerase
Inorganic Pyrophosphatase
Enzyme Dilution Buffer
Glycerol Enzyme Dilution Buffer
Sequenase Reaction Buffer (5X)
Dithiothreitol Solution
Mn Buffer

Control DNA M13 mp18
Primer (-40 Universal)
Labeling Mix (dGTP, 5X)
ddGTP Termination Mix (for dGTP)
ddATP Termination Mix (for dGTP)
ddTTP Termination Mix (for dGTP)
ddCTP Termination Mix (for dGTP)
Sequencing Extending Mix (for dGTP)

Labeling Mix (dITP, 5X)
ddGTP Termination Mix (for dITP)
ddATP Termination Mix (for dITP)
ddTTP Termination Mix (for dITP)
ddCTP Termination Mix (for dITP)
Sequence Extending Mix (for dITP)

Stop Solution
Protocol Book

This kit and all the enclosed reagents should be stored frozen at -20°C (NOT in a frost-free freezer). Keep all reagents on ice when removed from storage for use. Sequenase Version 2.0 enzyme must be stored at -20°C. Never store Sequenase enzyme in a frost-free freezer since the temperature rises above 0°C daily. If enzyme dilution buffer (no glycerol) is to be used, only dilute the amount of enzyme which is to be used that day. Dilute into ice-cold buffer and keep on ice until use.

References:
TABOR, S. AND RICHARDSON C. C. (1989) J. Biol. Chem. 264, 6447-6458.
FULLER, C. W. (1989) Comments 16, No. 3, United States Biochemical Corp., Cleveland, OH.
TABOR, S. AND RICHARDSON, C. C. (1989) Proc. Nat. Acad. Sci. USA 86, 4076-4080.
RUAN, C. C., SAMOLS, S. B. AND FULLER, C. W. (1990) Comments 17, No. 1, United States Biochemical Corp., Cleveland, OH.
TABOR, S. AND RICHARDSON C. C. (1990) J. Biol. Chem. 265, 8322-8328.
TABOR, S. AND RICHARDSON, C. C. (1989) Proc. Nat. Acad. Sci. USA 84, 4767-4771.
PISA-WILLIAMSON, D. AND FULLER, C. W. (1992) Comments 19, No. 2, United States Biochemical Corp., Cleveland, OH.

T7 DNA Polymerase (10 U/µL) (Thermo Scientific™)

Thermo Scientific T7 DNA Polymerase, a template dependent DNA polymerase, catalyzes DNA synthesis in the 5'→3' direction. It is a highly processive DNA polymerase allowing continuous synthesis of long stretches of DNA. The enzyme also exhibits a high 3'→5' exonuclease activity towards single- and double-stranded DNA.

Highlights

Strong 3'→5' exonuclease activity, approximately 1000-fold greater than Klenow Fragment
Active in restriction enzyme buffers

Applications

• Purification of covalently closed circular DNA by removal of residual genomic DNA
• Primer extension reactions on long templates (see​ Reference 1)
• DNA 3'-end labeling (see​ Reference 1)
• Strand extensions in site-directed mutagenesis
• Fill-in blunting of 5'-overhang DNA
• Second strand synthesis of cDNA
In situ detection of DNA fragmentation associated with apoptosis

Note

Assays at 37°C require only short incubation times .

SP6 RNA Polymerase, HC (≥100 U/µL) (Thermo Scientific™)

Thermo Scientific Bacteriophage SP6 RNA polymerase is a DNA-dependent RNA polymerase with strict specificity for its respective double-stranded promoters. It catalyzes the 5'→3' synthesis of RNA on either single-stranded DNA or double-stranded DNA downstream from its promoter and incorporates modified nucleotides.

Highlights

Incorporates modified nucleotides (e.g., aminoallyl-, biotin-, fluorescein-, digoxigenin-labeled nucleotides)

Applications

• Synthesis of unlabeled and labeled RNA that can be used:
• For hybridization, in vitro RNA translation
• As aRNA, siRNA, substrate in RNase protection assays, template for genomic DNA sequencing
• In studies of RNA secondary structure and RNA-protein interactions, RNA splicing

Consensus promoter sequence:
SP6: ATTTAGGTGACACTATAGAAGNG

SP6 RNA Polymerase (20 U/µL) (Thermo Scientific™)

Thermo Scientific Bacteriophage SP6 RNA polymerase is a DNA-dependent RNA polymerase with strict specificity for its respective double-stranded promoters. It catalyzes the 5'→3' synthesis of RNA on either single-stranded DNA or double-stranded DNA downstream from its promoter and incorporates modified nucleotides.

Highlights

Incorporates modified nucleotides (e.g., aminoallyl-, biotin-, fluorescein-, digoxigenin-labeled nucleotides)

Applications

• Synthesis of unlabeled and labeled RNA that can be used:
• For hybridization, in vitro RNA translation
• As aRNA, siRNA, substrate in RNase protection assays, template for genomic DNA sequencing
• In studies of RNA secondary structure and RNA-protein interactions, RNA splicing

Consensus promoter sequence:
SP6: ATTTAGGTGACACTATAGAAGNG

T7 RNA Polymerase, HC (200 U/µL) (Thermo Scientific™)

Thermo Scientific Bacteriophage T7 RNA polymerase is a DNA-dependent RNA polymerase with strict specificity for its respective double-stranded promoters. It catalyzes the 5'→3' synthesis of RNA on either single-stranded DNA or double-stranded DNA downstream from it promoter.

Highlights

• Incorporates modified nucleotides (e.g., aminoallyl-, biotin-, fluorescein-, digoxigenin-labeled nucleotides)

Applications

Synthesis of unlabeled and labeled RNA that can be used:

• For hybridization, in vitro RNA translation
• As aRNA, siRNA, substrate in RNase protection assays, template for genomic DNA sequencing
• In studies of RNA secondary structure and RNA-protein interactions, RNA splicing

Consensus promoter sequence:
T7: TAATACGACTCACTATAGGGAGA